National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4683R-1 
 Symbol CG4683  Full Name CG4683 
 CG No CG4683  Old CG No CG4683 
 Synonyms CG4683 
 Accession No (Link to NCBI) NM_141781.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCTATGTTAGAGACAAGGCG 
 Primer Seq. 3'
aatctagaggtaccAATCCGTCATTGAGGGCGGTT 
 Predicted Fragment Size
361 
 IR fragment full Seq
0001 AGCTATGTTA GAGACAAGGC GATCGAATTC GATTCAGTTC ATGTTTATAC CGGTCCTCTG 
0061 TTTATGCCCC AAAGGATAAC GTTCAGGAAC TGGTCTGTGC GTTACCATGT AATGGGCATG 
0121 AACACGGTTG CTGTTCCAAC GCACTTCTTC AAAATCATCA TAAGAGAGGA TGAGTTTAAT 
0181 AGGGATATGC CCATTATGGA AGGTTATGTT GTTCCCAATG CATATGTCGA CAAGGATATG 
0241 GATCTGCGCT CATTTTTAGC CGATGTTCGT GATATTGAAC ACTTCGCAGG ACTCAAATTC 
0301 TGTGATGGCC AGCAGCGGGA TCAACTTGAA TTGCCTGTAA AACCGCCCTC AATGACGGAT 
0361 T 
 in silico PCR Fragment
0001 AGCTATGTTA GAGACAAGGC GATCGAATTC GATTCAGTTC ATGTTTATAC CGGTCCTCTG 
0061 TTTATGCCCC AAAGGATAAC GTTCAGGAAC TGGTCTGTGC GTTACCATGT AATGGGCATG 
0121 AACACGGTTG CTGTTCCAAC GCACTTCTTC AAAATCATCA TAAGAGAGGA TGAGTTTAAT 
0181 AGGGATATGC CCATTATGGA AGGTTATGTT GTTCCCAATG CATATGTCGA CAAGGATATG 
0241 GATCTGCGCT CATTTTTAGC CGATGTTCGT GATATTGAAC ACTTCGCAGG ACTCAAATTC 
0301 TGTGATGGCC AGCAGCGGGA TCAACTTGAA TTGCCTGTAA AACCGCCCTC AATGACGGAT 
0361 T 
 Assemble Data

4683R-1.IR_full       1   AGCTATGTTAGAGACAAGGCGATCGAATTCGATTCAGTTCATGTTTATACCGGTCCTCTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4683R-1.in silico     1   AGCTATGTTAGAGACAAGGCGATCGAATTCGATTCAGTTCATGTTTATACCGGTCCTCTG 60


4683R-1.IR_full       61  TTTATGCCCCAAAGGATAACGTTCAGGAACTGGTCTGTGCGTTACCATGTAATGGGCATG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4683R-1.in silico     61  TTTATGCCCCAAAGGATAACGTTCAGGAACTGGTCTGTGCGTTACCATGTAATGGGCATG 120


4683R-1.IR_full       121 AACACGGTTGCTGTTCCAACGCACTTCTTCAAAATCATCATAAGAGAGGATGAGTTTAAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4683R-1.in silico     121 AACACGGTTGCTGTTCCAACGCACTTCTTCAAAATCATCATAAGAGAGGATGAGTTTAAT 180


4683R-1.IR_full       181 AGGGATATGCCCATTATGGAAGGTTATGTTGTTCCCAATGCATATGTCGACAAGGATATG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4683R-1.in silico     181 AGGGATATGCCCATTATGGAAGGTTATGTTGTTCCCAATGCATATGTCGACAAGGATATG 240


4683R-1.IR_full       241 GATCTGCGCTCATTTTTAGCCGATGTTCGTGATATTGAACACTTCGCAGGACTCAAATTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4683R-1.in silico     241 GATCTGCGCTCATTTTTAGCCGATGTTCGTGATATTGAACACTTCGCAGGACTCAAATTC 300


4683R-1.IR_full       301 TGTGATGGCCAGCAGCGGGATCAACTTGAATTGCCTGTAAAACCGCCCTCAATGACGGAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4683R-1.in silico     301 TGTGATGGCCAGCAGCGGGATCAACTTGAATTGCCTGTAAAACCGCCCTCAATGACGGAT 360


4683R-1.IR_full       361 T 361
                          |
4683R-1.in silico     361 T 361

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   343  NM_141781.1  CG4683-RA (CG4683), mRNA 
0   21  NM_164466.1  CG32463-RA (CG32463), mRNA 
0   NM_167418.1  CG9517-RB, transcript variant B (CG9517), mRNA 
0   NM_131959.1  CG15471-RA (CG15471), mRNA 
0   NM_136283.2  CG1428-RA (CG1428), mRNA 
0   NM_205878.1  CG11148-RC, transcript variant C (CG11148), mRNA 
0   NM_143693.2  CG11148-RA, transcript variant A (CG11148), mRNA 
0   NM_205879.1  CG11148-RB, transcript variant B (CG11148), mRNA 
0   NM_140043.3  CG4347-RA, transcript variant A (UGP), mRNA 
0   NM_001014484.1  CG15279-RC, transcript variant C (CG15279), mRNA 
0   NM_168325.2  CG4347-RC, transcript variant C (UGP), mRNA 
0   NM_136334.2  CG8245-RA (CG8245), mRNA 
0   NM_140741.2  CG7510-RA (CG7510), mRNA 
0   NM_079700.1  CG3723-RA (Dhc93AB), mRNA 
0   NM_164671.1  CG9088-RB, transcript variant B (lid), mRNA 
0   NM_078762.4  CG9088-RA, transcript variant A (lid), mRNA 
0   NM_169935.1  CG31191-RA (CG31191), mRNA 
0   NM_057669.2  CG12399-RA (Mad), mRNA 
0   NM_134768.3  CG17660-RA (CG17660), mRNA 
0   NM_132146.1  CG17063-RA (inx6), mRNA 
0   NM_137659.2  CG11132-RA (DMAP1), mRNA 
0   NM_057592.3  CG4265-RA (Uch), mRNA 
0   NM_132972.1  CG12995-RB, transcript variant B (CG12995), mRNA 
0   NM_167561.1  CG12995-RA, transcript variant A (CG12995), mRNA 
0   NM_167466.1  CG9012-RB, transcript variant B (Chc), mRNA 
0   NM_057694.2  CG9012-RA, transcript variant A (Chc), mRNA 
0   NM_206728.1  CG9012-RD, transcript variant D (Chc), mRNA 
0   NM_206729.1  CG9012-RC, transcript variant C (Chc), mRNA 
0   NM_141006.1  CG12452-RA (CG12452), mRNA 
0   NM_130545.2  CG11411-RA (fs(1)N), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.