National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4678R-4 
 Symbol CG4678  Full Name CG4678 
 CG No CG4678  Old CG No CG4678 
 Synonyms CG4678 
 Accession No (Link to NCBI) NM_001038761.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCACTGCCTTGTACTCCATC 
 Primer Seq. 3'
aatctagaggtaccGGACTGGAGTTCGGCGTATTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTCACTGCCT TGTACTCCAT CGGAAAATCC ATCCAGGGAC GTGATCTTTG GGTAATGGTG 
0061 GTCAGCTCGT CGCCATATGA GCATATGGTG GGCAAGCCGG ATGTGAAGTA CGTGGGCAAT 
0121 ATCCACGGAA ACGAGCCAGT CGGCCGGGAG ATGCTGCTCC ACCTCATCCA GTATTTCGTG 
0181 ACCAGCTACA ACACGGATCA GTACGTCAAA TGGCTGCTGG ACAACACACG GATTCACATT 
0241 CTGCCCACAA TGAATCCGGA TGGTTATGCG GTTTCCAAGG AGGGCACATG CGATGGTGGC 
0301 CAAGGAAGAT ATAATGCCCG TGGATTCGAT CTGAATCGCA ACTTTCCCGA CTATTTCAAG 
0361 CAGAACAACA AACGGGGTCA GCCAGAAACG GATTCGGTAA AGGATTGGAT ATCCAAGATT 
0421 CAGTTCGTGC TCAGTGGAAG CCTGCATGGT GGTGCCCTGG TGGCCAGTTA TCCGTACGAC 
0481 AATACGCCGA ACTCCAGTAA  
 in silico PCR Fragment
0001 CTCACTGCCT TGTACTCCAT CGGAAAATCC ATCCAGGGAC GTGATCTTTG GGTAATGGTG 
0061 GTCAGCTCGT CGCCATATGA GCACATGGTG GGTAAGCCGG ATGTGAAGTA CGTGGGCAAT 
0121 ATCCACGGAA ACGAGCCAGT CGGCCGGGAG ATGCTGCTCC ACCTCATCCA GTATTTCGTG 
0181 ACCAGCTACA ACACGGATCA GTACGTCAAA TGGCTGCTGG ACAACACACG GATTCACATT 
0241 CTGCCCACAA TGAATCCGGA TGGTTATGCG GTTTCCAAGG AGGGCACATG CGATGGTGGC 
0301 CAAGGAAGAT ATAATGCCCG TGGATTCGAT CTGAATCGCA ACTTTCCCGA CTATTTCAAG 
0361 CAGAACAACA AACGGGGTCA GCCAGAAACG GATTCGGTAA AGGATTGGAT ATCCAAGATT 
0421 CAGTTCGTGC TCAGTGGAAG CCTGCATGGT GGTGCCCTGG TGGCCAGTTA TCCGTACGAC 
0481 AATACGCCGA ACTCCAGTAA  
 Assemble Data

4678R-4.IR_full       1   CTCACTGCCTTGTACTCCATCGGAAAATCCATCCAGGGACGTGATCTTTGGGTAATGGTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4678R-4.in silico     1   CTCACTGCCTTGTACTCCATCGGAAAATCCATCCAGGGACGTGATCTTTGGGTAATGGTG 60


4678R-4.IR_full       61  GTCAGCTCGTCGCCATATGAGCATATGGTGGGCAAGCCGGATGTGAAGTACGTGGGCAAT 120
                          ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||
4678R-4.in silico     61  GTCAGCTCGTCGCCATATGAGCACATGGTGGGTAAGCCGGATGTGAAGTACGTGGGCAAT 120


4678R-4.IR_full       121 ATCCACGGAAACGAGCCAGTCGGCCGGGAGATGCTGCTCCACCTCATCCAGTATTTCGTG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4678R-4.in silico     121 ATCCACGGAAACGAGCCAGTCGGCCGGGAGATGCTGCTCCACCTCATCCAGTATTTCGTG 180


4678R-4.IR_full       181 ACCAGCTACAACACGGATCAGTACGTCAAATGGCTGCTGGACAACACACGGATTCACATT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4678R-4.in silico     181 ACCAGCTACAACACGGATCAGTACGTCAAATGGCTGCTGGACAACACACGGATTCACATT 240


4678R-4.IR_full       241 CTGCCCACAATGAATCCGGATGGTTATGCGGTTTCCAAGGAGGGCACATGCGATGGTGGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4678R-4.in silico     241 CTGCCCACAATGAATCCGGATGGTTATGCGGTTTCCAAGGAGGGCACATGCGATGGTGGC 300


4678R-4.IR_full       301 CAAGGAAGATATAATGCCCGTGGATTCGATCTGAATCGCAACTTTCCCGACTATTTCAAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4678R-4.in silico     301 CAAGGAAGATATAATGCCCGTGGATTCGATCTGAATCGCAACTTTCCCGACTATTTCAAG 360


4678R-4.IR_full       361 CAGAACAACAAACGGGGTCAGCCAGAAACGGATTCGGTAAAGGATTGGATATCCAAGATT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4678R-4.in silico     361 CAGAACAACAAACGGGGTCAGCCAGAAACGGATTCGGTAAAGGATTGGATATCCAAGATT 420


4678R-4.IR_full       421 CAGTTCGTGCTCAGTGGAAGCCTGCATGGTGGTGCCCTGGTGGCCAGTTATCCGTACGAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4678R-4.in silico     421 CAGTTCGTGCTCAGTGGAAGCCTGCATGGTGGTGCCCTGGTGGCCAGTTATCCGTACGAC 480


4678R-4.IR_full       481 AATACGCCGAACTCCAGTAA 500
                          ||||||||||||||||||||
4678R-4.in silico     481 AATACGCCGAACTCCAGTAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001038761.1  CG4678-RC, transcript variant C (CG4678), mRNA 
99.17   478  NM_167536.2  CG4678-RB, transcript variant B (CG4678), mRNA 
99.17   478  NM_132924.2  CG4678-RA, transcript variant A (CG4678), mRNA 
0   10  21  NM_206596.1  CG4122-RG, transcript variant G (svr), mRNA 
0   10  21  NM_080293.3  CG4122-RB, transcript variant B (svr), mRNA 
0   14  NM_206599.1  CG4122-RD, transcript variant D (svr), mRNA 
0   13  NM_176679.2  CG4122-RC, transcript variant C (svr), mRNA 
0   13  NM_166846.3  CG4122-RA, transcript variant A (svr), mRNA 
0   NM_080516.1  CG16757-RA (Spn), mRNA 
0   NM_001038822.1  CG31732-RG, transcript variant G (yuri), mRNA 
0   NM_165106.4  CG31732-RB, transcript variant B (yuri), mRNA 
0   NM_001038821.1  CG31732-RF, transcript variant F (yuri), mRNA 
0   NM_001038820.1  CG31732-RE, transcript variant E (yuri), mRNA 
0   NM_166592.1  CG30417-RA (CG30417), mRNA 
0   NM_137125.2  CG12869-RA (CG12869), mRNA 
0   NM_057710.3  CG17248-RA, transcript variant A (n-syb), mRNA 
0   NM_206234.1  CG17248-RE, transcript variant E (n-syb), mRNA 
0   NM_167904.1  CG17248-RC, transcript variant C (n-syb), mRNA 
0   NM_167906.1  CG17248-RD, transcript variant D (n-syb), mRNA 
0   NM_167905.1  CG17248-RB, transcript variant B (n-syb), mRNA 
0   NM_169558.1  CG9285-RC, transcript variant C (Dip-B), mRNA 
0   NM_142061.2  CG9285-RA, transcript variant A (Dip-B), mRNA 
0   NM_169557.1  CG9285-RB, transcript variant B (Dip-B), mRNA 
0   NM_165009.1  CG31763-RA (CG31763), mRNA 
0   16  NM_206597.1  CG4122-RF, transcript variant F (svr), mRNA 
0   NM_169094.1  CG1093-RA, transcript variant A (plx), mRNA 
0   NM_079712.2  CG18402-RA (InR), mRNA 
0   NM_144368.2  CG4739-RA (Ugt86Dc), mRNA 
0   NM_142244.1  CG4546-RA (CG4546), mRNA 
0   NM_132800.1  CG15642-RA (CG15642), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.