National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4678R-1 
 Symbol CG4678  Full Name CG4678 
 CG No CG4678  Old CG No CG4678 
 Synonyms CG4678 
 Accession No (Link to NCBI) NM_001038761.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CTCACTGCCTTGTACTCCATCGGAAAATCCATCCAGGGACGTGATCTTTGGGTAATGGTG 60

                          ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| silico     61  GTCAGCTCGTCGCCATATGAGCACATGGTGGGTAAGCCGGATGTGAAGTACGTGGGCAAT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATCCACGGAAACGAGCCAGTCGGCCGGGAGATGCTGCTCCACCTCATCCAGTATTTCGTG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACCAGCTACAACACGGATCAGTACGTCAAATGGCTGCTGGACAACACACGGATTCACATT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTGCCCACAATGAATCCGGATGGTTATGCGGTTTCCAAGGAGGGCACATGCGATGGTGGC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAAGGAAGATATAATGCCCGTGGATTCGATCTGAATCGCAACTTTCCCGACTATTTCAAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAGAACAACAAACGGGGTCAGCCAGAAACGGATTCGGTAAAGGATTGGATATCCAAGATT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CAGTTCGTGCTCAGTGGAAGCCTGCATGGTGGTGCCCTGGTGGCCAGTTATCCGTACGAC 480

4678R-1.IR_full       481 AATACGCCGAACTCCAGTAA 500
                          |||||||||||||||||||| silico     481 AATACGCCGAACTCCAGTAA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001038761.1  CG4678-RC, transcript variant C (CG4678), mRNA 
99.17   478  NM_167536.2  CG4678-RB, transcript variant B (CG4678), mRNA 
99.17   478  NM_132924.2  CG4678-RA, transcript variant A (CG4678), mRNA 
0   10  21  NM_206596.1  CG4122-RG, transcript variant G (svr), mRNA 
0   10  21  NM_080293.3  CG4122-RB, transcript variant B (svr), mRNA 
0   14  NM_206599.1  CG4122-RD, transcript variant D (svr), mRNA 
0   13  NM_176679.2  CG4122-RC, transcript variant C (svr), mRNA 
0   13  NM_166846.3  CG4122-RA, transcript variant A (svr), mRNA 
0   NM_080516.1  CG16757-RA (Spn), mRNA 
0   NM_001038822.1  CG31732-RG, transcript variant G (yuri), mRNA 
0   NM_165106.4  CG31732-RB, transcript variant B (yuri), mRNA 
0   NM_001038821.1  CG31732-RF, transcript variant F (yuri), mRNA 
0   NM_001038820.1  CG31732-RE, transcript variant E (yuri), mRNA 
0   NM_166592.1  CG30417-RA (CG30417), mRNA 
0   NM_137125.2  CG12869-RA (CG12869), mRNA 
0   NM_057710.3  CG17248-RA, transcript variant A (n-syb), mRNA 
0   NM_206234.1  CG17248-RE, transcript variant E (n-syb), mRNA 
0   NM_167904.1  CG17248-RC, transcript variant C (n-syb), mRNA 
0   NM_167906.1  CG17248-RD, transcript variant D (n-syb), mRNA 
0   NM_167905.1  CG17248-RB, transcript variant B (n-syb), mRNA 
0   NM_169558.1  CG9285-RC, transcript variant C (Dip-B), mRNA 
0   NM_142061.2  CG9285-RA, transcript variant A (Dip-B), mRNA 
0   NM_169557.1  CG9285-RB, transcript variant B (Dip-B), mRNA 
0   NM_165009.1  CG31763-RA (CG31763), mRNA 
0   16  NM_206597.1  CG4122-RF, transcript variant F (svr), mRNA 
0   NM_169094.1  CG1093-RA, transcript variant A (plx), mRNA 
0   NM_079712.2  CG18402-RA (InR), mRNA 
0   NM_144368.2  CG4739-RA (Ugt86Dc), mRNA 
0   NM_142244.1  CG4546-RA (CG4546), mRNA 
0   NM_132800.1  CG15642-RA (CG15642), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.