National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4587R-2 
 Symbol CG4587  Full Name CG4587 
 CG No CG4587  Old CG No CG4587 
 Synonyms DS07108.2, BG:DS07108.2, CG4587 
 Accession No (Link to NCBI) NM_135918.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACAATGCCGATGGCAAGCTG 
 Primer Seq. 3'
aatctagaggtaccGTTTTTACCACCTCCGAGAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACAATGCCG ATGGCAAGCT GGCGGACGGA GCCCGCCACA TGGACATCCG GTTTCATGCG 
0061 GCGCTTCGAG CGcCTGCNCG GTCAATCTCA GTCTAAGCTC GATTCTGGTC CCGCACGGCG 
0121 TCGACTTGGA TGAGCCGGAC GTGAAGTCGG NGCTGCAGTG GAGCGGCCAT TTGGATCCGC 
0181 TGTTCCAGAA CAACTTAGAG CAAGATCCGG CATTGTCGTG GCAATACTTT GGCTCCTCCA 
0241 CAGGCTTTCT GCGCCGCTTC CCGGGCACCG CCTGGCCCCC GGAGGGCTCC AAGGGCAGCA 
0301 AGCTCATCCA CGACTTCCGC ACGCACAATT GGTTCGTCCA GGCCGCCTCG TCGCCCAAGG 
0361 ACATTATGAT TCTTTTGGAT GCCTCATCGA GCATGACAGA GAAGTCCTTT GACCTGGGGA 
0421 TGGCCACCGC CTTTAACATA TTGGACACCC TCGGTGAAGA TGATTTCGTT AACCTCATTA 
0481 CCTTCTCGGA GGTGGTAAAA AC 
 in silico PCR Fragment
0001 TACAATGCCG ATGGCAAGCT GGCGGACGGA GCCCGCCACA TGGACATCCG G-TTCATGCG 
0061 GCGCTTCGAG CGCCTGC-CG GTCAATCTCA GTCTAAGCTC GATTCTGGTC CCGCACGGCG 
0121 TCGACTTGGA TGAGCCGGAC GTGAAGTCGG CGCTGCAGTG GAGCGGCCAT TTGGATCCGC 
0181 TGTTCCAGAA CAACTTAGAG CAAGATCCGG CATTGTCGTG GCAATACTTT GGCTCCTCCA 
0241 CAGGCTTTCT GCGCCGCTTC CCGGGCACCG CCTGGCCCCC GGAGGGCTCC AAGGGCAGCA 
0301 AGCTCATCCA CGACTTCCGC ACGCACAATT GGTTCGTCCA GGCCGCCTCG TCGCCCAAGG 
0361 ACATTATGAT TCTTTTGGAT GCCTCATCGA GCATGACAGA GAAGTCCTTT GACCTGGGGA 
0421 TGGCCACCGC CTTTAACATA TTGGACACCC TCGGTGAAGA TGATTTCGTT AACCTCATTA 
0481 CCTTCTCGGA GGTGGTAAAA AC 
 Assemble Data

4587R-2.IR_full       1   TACAATGCCGATGGCAAGCTGGCGGACGGAGCCCGCCACATGGACATCCGGTTTCATGCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
4587R-2.in silico     1   TACAATGCCGATGGCAAGCTGGCGGACGGAGCCCGCCACATGGACATCCGG-TTCATGCG 60


4587R-2.IR_full       61  GCGCTTCGAGCGCCTGCNCGGTCAATCTCAGTCTAAGCTCGATTCTGGTCCCGCACGGCG 120
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
4587R-2.in silico     61  GCGCTTCGAGCGCCTGC-CGGTCAATCTCAGTCTAAGCTCGATTCTGGTCCCGCACGGCG 120


4587R-2.IR_full       121 TCGACTTGGATGAGCCGGACGTGAAGTCGGNGCTGCAGTGGAGCGGCCATTTGGATCCGC 180
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
4587R-2.in silico     121 TCGACTTGGATGAGCCGGACGTGAAGTCGGCGCTGCAGTGGAGCGGCCATTTGGATCCGC 180


4587R-2.IR_full       181 TGTTCCAGAACAACTTAGAGCAAGATCCGGCATTGTCGTGGCAATACTTTGGCTCCTCCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4587R-2.in silico     181 TGTTCCAGAACAACTTAGAGCAAGATCCGGCATTGTCGTGGCAATACTTTGGCTCCTCCA 240


4587R-2.IR_full       241 CAGGCTTTCTGCGCCGCTTCCCGGGCACCGCCTGGCCCCCGGAGGGCTCCAAGGGCAGCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4587R-2.in silico     241 CAGGCTTTCTGCGCCGCTTCCCGGGCACCGCCTGGCCCCCGGAGGGCTCCAAGGGCAGCA 300


4587R-2.IR_full       301 AGCTCATCCACGACTTCCGCACGCACAATTGGTTCGTCCAGGCCGCCTCGTCGCCCAAGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4587R-2.in silico     301 AGCTCATCCACGACTTCCGCACGCACAATTGGTTCGTCCAGGCCGCCTCGTCGCCCAAGG 360


4587R-2.IR_full       361 ACATTATGATTCTTTTGGATGCCTCATCGAGCATGACAGAGAAGTCCTTTGACCTGGGGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4587R-2.in silico     361 ACATTATGATTCTTTTGGATGCCTCATCGAGCATGACAGAGAAGTCCTTTGACCTGGGGA 420


4587R-2.IR_full       421 TGGCCACCGCCTTTAACATATTGGACACCCTCGGTGAAGATGATTTCGTTAACCTCATTA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4587R-2.in silico     421 TGGCCACCGCCTTTAACATATTGGACACCCTCGGTGAAGATGATTTCGTTAACCTCATTA 480


4587R-2.IR_full       481 CCTTCTCGGAGGTGGTAAAAAC 502
                          ||||||||||||||||||||||
4587R-2.in silico     481 CCTTCTCGGAGGTGGTAAAAAC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135918.2  CG4587-RA (CG4587), mRNA 
0   NM_137058.2  CG12295-RB (stj), mRNA 
0   NM_135935.2  CG12455-RA, transcript variant A (CG12455), mRNA 
0   NM_165149.1  CG12455-RB, transcript variant B (CG12455), mRNA 
0   NM_137851.2  CG2852-RA, transcript variant A (CG2852), mRNA 
0   NM_137046.3  CG6191-RA (CG6191), mRNA 
0   NM_168039.1  CG32264-RB, transcript variant B (CG32264), mRNA 
0   NM_168037.1  CG32264-RA, transcript variant A (CG32264), mRNA 
0   NM_206268.1  CG32264-RC, transcript variant C (CG32264), mRNA 
0   NM_168038.1  CG32264-RD, transcript variant D (CG32264), mRNA 
0   NM_138079.1  CG13582-RA (CG13582), mRNA 
0   NM_176240.1  CG33152-RA (hbn), mRNA 
0   NM_139858.2  CG8564-RA (CG8564), mRNA 
0   NM_142339.1  CG5169-RA (CG5169), mRNA 
0   NM_164731.1  CG11266-RE, transcript variant E (CG11266), mRNA 
0   NM_135251.2  CG11266-RB, transcript variant B (CG11266), mRNA 
0   NM_164733.1  CG11266-RD, transcript variant D (CG11266), mRNA 
0   NM_164734.1  CG11266-RF, transcript variant F (CG11266), mRNA 
0   NM_164735.1  CG11266-RG, transcript variant G (CG11266), mRNA 
0   NM_164732.1  CG11266-RC, transcript variant C (CG11266), mRNA 
0   NM_164730.1  CG11266-RA, transcript variant A (CG11266), mRNA 
0   NM_206208.1  CG5472-RB, transcript variant B (Pal), mRNA 
0   NM_080379.3  CG5472-RA, transcript variant A (Pal), mRNA 
0   NM_206207.1  CG5472-RC, transcript variant C (Pal), mRNA 
0   NM_057591.3  CG7562-RA (Trf), mRNA 
0   NM_167599.1  CG7536-RB, transcript variant B (CG7536), mRNA 
0   NM_133037.2  CG7536-RA, transcript variant A (CG7536), mRNA 
0   NM_057483.3  CG10181-RA (Mdr65), mRNA 
0   NM_141682.2  CG8412-RA (CG8412), mRNA 
0   NM_142956.1  CG18428-RA (CG18428), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.