National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4558R-2 
 Symbol CG4558  Full Name CG4558 
 CG No CG4558  Old CG No CG4558 
 Synonyms CG4558 
 Accession No (Link to NCBI) NM_132134.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGTGCCGAAGTGGAGACCGT 
 Primer Seq. 3'
aatctagaggtaccTGGTGGGTCGCAGGATGATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGTGCCGAA GTGGAGACCG TCTGGCTGGA GGGCGAGGAG TGTGCAAATG GTCATCCGCT 
0061 GGAGTACCAT CAGAACCACA AGTGCCATCA GCCGGAGGNA TCGCCCATCG CCTTTAGGAG 
0121 CAACCAGCAG GAGTCCATTG ACTTGAGCCA CTTCTACAAC ATCTACGCTA GCAATCATCA 
0181 GATCTTCCCA GCGCGACGCN TANTCGGGTG CACTCGACCA ACCAGGATGT GCACAATCTT 
0241 GAGGATCTCT TTgGGCAGTT CAACAGCAGC TGGACCCAGC AGGCGCACAA TCTTTgGNGC 
0301 TGCNATCGCA TNCTGCCCGC GCGACTCCTG CGTCCCATTT TCGCCCGGCC AACGCGANTG 
0361 NCCAGCAtNG GCGTGGCCCT GGAGCGTTAT GTGGCCATCG ATACTGCCCA GGCGCCGGCC 
0421 TACACATTGC CGGAAACGGA ATGCCCCAAT GTCTATATAC ACCAGGCGGT AGGCACGCGG 
0481 TTCATCATCC TGCGACCCAC CA 
 in silico PCR Fragment
0001 GTGTGCCGAA GTGGAGACCG TCTGGCTGGA GGGCGAGGAG TGTGCAAATG GTCATCCGCT 
0061 GGAGTACCAT CAGAACCACA AGTGCCATCA GCCGGAGGGA TCGCCCATCG CCTTTAGGAG 
0121 CAACCAGCAG GAGTCCATTG ACTTGAGCCA CTTCTACAAC ATCTACGCTA GCAATCATCA 
0181 GATCTT-CCA GCGCGACGCG TA-TCGGGTG CACTCGACCA ACCAGGATGT GCACAATCTT 
0241 GAGGATCTCT TTGGGCAGTT CAACAGCAGC TGGACCCAGC AGGCGCACAA TCTTTGGCGC 
0301 TGCAATCGCA TGCTGCCCGC GCGACTCCTG CGTCCCATTT TCGCCCGGCC AACGCGATTG 
0361 CCCAGCATGG GCGTGGCCCT GGAGCGTTAT GTGGCCATCG ATACTGCCCA GGCGCCGGCC 
0421 TACACATTGC CGGAAACGGA ATGCCCCAAT GTCTATATAC ACCAGGCGGT AGGCACGCGG 
0481 TTCATCATCC TGCGACCCAC CA 
 Assemble Data

4558R-2.IR_full        1   TGTGCCGAAGTGGAGACCGTCTGGCTGGAGGGCGAGGAGTGTGCAAATGGTCATCCGCT 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4558R-2.in silico      1   TGTGCCGAAGTGGAGACCGTCTGGCTGGAGGGCGAGGAGTGTGCAAATGGTCATCCGCT 59


4558R-2.IR_full       61  GGAGTACCATCAGAACCACAAGTGCCATCAGCCGGAGGNATCGCCCATCGCCTTTAGGAG 119
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
4558R-2.in silico     61  GGAGTACCATCAGAACCACAAGTGCCATCAGCCGGAGGGATCGCCCATCGCCTTTAGGAG 119


4558R-2.IR_full       121 CAACCAGCAGGAGTCCATTGACTTGAGCCACTTCTACAACATCTACGCTAGCAATCATCA 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4558R-2.in silico     121 CAACCAGCAGGAGTCCATTGACTTGAGCCACTTCTACAACATCTACGCTAGCAATCATCA 179


4558R-2.IR_full       181 GATCTTCCCAGCGCGACGCNTANTCGGGTGCACTCGACCAACCAGGATGTGCACAATCTT 239
                          |||||| |||||||||||| || |||||||||||||||||||||||||||||||||||||
4558R-2.in silico     181 GATCTT-CCAGCGCGACGCGTA-TCGGGTGCACTCGACCAACCAGGATGTGCACAATCTT 239


4558R-2.IR_full       241 GAGGATCTCTTTGGGCAGTTCAACAGCAGCTGGACCCAGCAGGCGCACAATCTTTGGNGC 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
4558R-2.in silico     241 GAGGATCTCTTTGGGCAGTTCAACAGCAGCTGGACCCAGCAGGCGCACAATCTTTGGCGC 299


4558R-2.IR_full       301 TGCNATCGCATNCTGCCCGCGCGACTCCTGCGTCCCATTTTCGCCCGGCCAACGCGANTG 359
                          ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||
4558R-2.in silico     301 TGCAATCGCATGCTGCCCGCGCGACTCCTGCGTCCCATTTTCGCCCGGCCAACGCGATTG 359


4558R-2.IR_full        361 CCAGCATNGGCGTGGCCCTGGAGCGTTATGTGGCCATCGATACTGCCCAGGCGCCGGCC 418
                           ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
4558R-2.in silico      361 CCAGCATGGGCGTGGCCCTGGAGCGTTATGTGGCCATCGATACTGCCCAGGCGCCGGCC 418


4558R-2.IR_full       421 TACACATTGCCGGAAACGGAATGCCCCAATGTCTATATACACCAGGCGGTAGGCACGCGG 478
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4558R-2.in silico     421 TACACATTGCCGGAAACGGAATGCCCCAATGTCTATATACACCAGGCGGTAGGCACGCGG 478


4558R-2.IR_full       481 TTCATCATCCTGCGACCCACCA 500
                          ||||||||||||||||||||||
4558R-2.in silico     481 TTCATCATCCTGCGACCCACCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132134.2  CG4558-RA (CG4558), mRNA 
0   NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
0   NM_176459.1  CG17228-RD, transcript variant D (pros), mRNA 
0   NM_079593.3  CG17228-RC, transcript variant C (pros), mRNA 
0   NM_134528.1  CG9572-RA (CG9572), mRNA 
0   NM_139453.1  CG13804-RA (yellow-g2), mRNA 
0   NM_167706.1  CG1702-RA (CG1702), mRNA 
0   NM_079599.3  CG14719-RA (I-t), mRNA 
0   NM_139932.2  CG7366-RA (CG7366), mRNA 
0   NM_170581.1  CG31000-RB, transcript variant B (heph), mRNA 
0   NM_170582.2  CG31000-RA, transcript variant A (heph), mRNA 
0   NM_176597.1  CG31000-RE, transcript variant E (heph), mRNA 
0   NM_176601.1  CG31000-RJ, transcript variant J (heph), mRNA 
0   NM_176602.1  CG31000-RK, transcript variant K (heph), mRNA 
0   NM_176596.1  CG31000-RD, transcript variant D (heph), mRNA 
0   NM_176603.1  CG31000-RH, transcript variant H (heph), mRNA 
0   NM_176599.1  CG31000-RG, transcript variant G (heph), mRNA 
0   NM_176598.1  CG31000-RF, transcript variant F (heph), mRNA 
0   NM_079964.2  CG31000-RC, transcript variant C (heph), mRNA 
0   NM_176600.1  CG31000-RI, transcript variant I (heph), mRNA 
0   18  NM_001032000.1  CG14681-RB, transcript variant B (CG14681), mRNA 
0   18  NM_001032002.1  CG33676-RA, transcript variant A (Skeletor), mRNA 
0   NM_142354.1  CG4090-RA (CG4090), mRNA 
0   NM_169059.1  CG2902-RA (Nmdar1), mRNA 
0   NM_135646.2  CG6230-RA (CG6230), mRNA 
0   NM_080340.2  CG2302-RA (nAcRalpha-7E), mRNA 
0   NM_137498.1  CG15069-RA, transcript variant A (Rgk2), mRNA 
0   NM_132339.2  CG32701-RA (l(1)G0320), mRNA 
0   NM_132897.1  CG4301-RA (CG4301), mRNA 
0   NM_142933.1  CG13597-RA (CG13597), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.