National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4558R-1 
 Symbol CG4558  Full Name CG4558 
 CG No CG4558  Old CG No CG4558 
 Synonyms CG4558 
 Accession No (Link to NCBI) NM_132134.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   TGTGCCGAAGTGGAGACCGTCTGGCTGGAGGGCGAGGAGTGTGCAAATGGTCATCCGCT 59

                          |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     61  GGAGTACCATCAGAACCACAAGTGCCATCAGCCGGAGGGATCGCCCATCGCCTTTAGGAG 119

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAACCAGCAGGAGTCCATTGACTTGAGCCACTTCTACAACATCTACGCTAGCAATCATCA 179

                          |||||| |||||||||||| || ||||||||||||||||||||||||||||||||||||| silico     181 GATCTT-CCAGCGCGACGCGTA-TCGGGTGCACTCGACCAACCAGGATGTGCACAATCTT 239

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     241 GAGGATCTCTTTGGGCAGTTCAACAGCAGCTGGACCCAGCAGGCGCACAATCTTTGGCGC 299

                          ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| || silico     301 TGCAATCGCATGCTGCCCGCGCGACTCCTGCGTCCCATTTTCGCCCGGCCAACGCGATTG 359

                           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico      361 CCAGCATGGGCGTGGCCCTGGAGCGTTATGTGGCCATCGATACTGCCCAGGCGCCGGCC 418

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TACACATTGCCGGAAACGGAATGCCCCAATGTCTATATACACCAGGCGGTAGGCACGCGG 478

4558R-1.IR_full       481 TTCATCATCCTGCGACCCACCA 500
                          |||||||||||||||||||||| silico     481 TTCATCATCCTGCGACCCACCA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132134.2  CG4558-RA (CG4558), mRNA 
0   NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
0   NM_176459.1  CG17228-RD, transcript variant D (pros), mRNA 
0   NM_079593.3  CG17228-RC, transcript variant C (pros), mRNA 
0   NM_134528.1  CG9572-RA (CG9572), mRNA 
0   NM_139453.1  CG13804-RA (yellow-g2), mRNA 
0   NM_167706.1  CG1702-RA (CG1702), mRNA 
0   NM_079599.3  CG14719-RA (I-t), mRNA 
0   NM_139932.2  CG7366-RA (CG7366), mRNA 
0   NM_170581.1  CG31000-RB, transcript variant B (heph), mRNA 
0   NM_170582.2  CG31000-RA, transcript variant A (heph), mRNA 
0   NM_176597.1  CG31000-RE, transcript variant E (heph), mRNA 
0   NM_176601.1  CG31000-RJ, transcript variant J (heph), mRNA 
0   NM_176602.1  CG31000-RK, transcript variant K (heph), mRNA 
0   NM_176596.1  CG31000-RD, transcript variant D (heph), mRNA 
0   NM_176603.1  CG31000-RH, transcript variant H (heph), mRNA 
0   NM_176599.1  CG31000-RG, transcript variant G (heph), mRNA 
0   NM_176598.1  CG31000-RF, transcript variant F (heph), mRNA 
0   NM_079964.2  CG31000-RC, transcript variant C (heph), mRNA 
0   NM_176600.1  CG31000-RI, transcript variant I (heph), mRNA 
0   18  NM_001032000.1  CG14681-RB, transcript variant B (CG14681), mRNA 
0   18  NM_001032002.1  CG33676-RA, transcript variant A (Skeletor), mRNA 
0   NM_142354.1  CG4090-RA (CG4090), mRNA 
0   NM_169059.1  CG2902-RA (Nmdar1), mRNA 
0   NM_135646.2  CG6230-RA (CG6230), mRNA 
0   NM_080340.2  CG2302-RA (nAcRalpha-7E), mRNA 
0   NM_137498.1  CG15069-RA, transcript variant A (Rgk2), mRNA 
0   NM_132339.2  CG32701-RA (l(1)G0320), mRNA 
0   NM_132897.1  CG4301-RA (CG4301), mRNA 
0   NM_142933.1  CG13597-RA (CG13597), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.