National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4555R-1 
 Symbol Smg1  Full Name Smg1 
 CG No CG32743  Old CG No CG4555 
 Synonyms smg1, rst(1a)cyr, CG4555, CG4549, CG32743, SMG1, clone 1.24, anon-EST:Liang-1.24, anon-WO0170980.133, Smg1 
 Accession No (Link to NCBI) NM_167095.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCGCAAGGAGCGCGAAACG 
 Primer Seq. 3'
aatctagaggtaccAGTGCCTCCGAGTGACCACGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCGCAAGG AgNGCGAAAC GCTGCTGACC CTGCTGGAGG CCTTCGTCTA CGATCCTCTG 
0061 GTTGATTGGA CCACCAACGA CGATGCTCAG GCACTGCGCC GATCGCTGAA CGCCAAACTC 
0121 CAGGAGTCGG CTGACGGTGG AGGAGCAGGT GGTCTGGGTG TCGGAGATCT TAAGTACCAC 
0181 AAGAAGGACA AGAATAAGGG AAAGCCACTT GATTCGGATG TCAAGCGACA GCCCTTCCTA 
0241 AGCAAACTGG GCATGCTGCA AAAGTACTGG TCCACCAACA AGACTGAGCT GATGCCGCAG 
0301 CTGGAGGAGA TGGAGCAGGA GGTGGGCAAC CTGCAGGCGG CACAGGCCAA GCAAGTGGTG 
0361 GCCGAGGAGG AGCTCGTGAA GCTCAACCAG CGCAGCGCCC TAATTGCCGA AATCAAATCG 
0421 CTGGGCACGG CGATCGAGAG CCATAGTTTC AATACTGCCT CGCTGCGTAA TGCCGTTCGT 
0481 CGTGGTCACT CGGAGGCACT  
 in silico PCR Fragment
0001 ATGCGCAAGG AGCGCGAAAC GCTGCTGACC CTGCTGGAGG CCTTCGTCTA CGATCCTCTG 
0061 GTTGATTGGA CCACCAACGA CGATGCTCAG GCACTGCGCC GATCGCTGAA CGCCAAACTC 
0121 CAGGAGTCGG CTGACGGTGG AGGAGCAGGT GGTCTGGGTG TCGGAGATCT TAAGTACCAC 
0181 AAGAAGGACA AGAATAAGGG AAAGCCACTT GATTCGGATG TCAAGCGACA GCCCTTCCTA 
0241 AGCAAACTGG GCATGCTGCA AAAGTACTGG TCCACCAACA AGACTGAGCT GATGCCGCAG 
0301 CTGGAGGAGA TGGAGCAGGA GGTGGGCAAC CTGCAGGCGG CACAGGCCAA GCAAGTGGTG 
0361 GCCGAGGAGG AGCTCGTGAA GCTCAACCAG CGCAGCGCCC TAATTGCCGA AATCAAATCG 
0421 CTGGGCACGG CGATCGAGAG CCATAGTTTC AATACGGCCT CGCTGCGTAA TGCCGTTCGT 
0481 CGTGGTCACT CGGAGGCACT  
 Assemble Data

4555R-1.IR_full       1   ATGCGCAAGGAGNGCGAAACGCTGCTGACCCTGCTGGAGGCCTTCGTCTACGATCCTCTG 60
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
4555R-1.in silico     1   ATGCGCAAGGAGCGCGAAACGCTGCTGACCCTGCTGGAGGCCTTCGTCTACGATCCTCTG 60


4555R-1.IR_full       61  GTTGATTGGACCACCAACGACGATGCTCAGGCACTGCGCCGATCGCTGAACGCCAAACTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4555R-1.in silico     61  GTTGATTGGACCACCAACGACGATGCTCAGGCACTGCGCCGATCGCTGAACGCCAAACTC 120


4555R-1.IR_full       121 CAGGAGTCGGCTGACGGTGGAGGAGCAGGTGGTCTGGGTGTCGGAGATCTTAAGTACCAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4555R-1.in silico     121 CAGGAGTCGGCTGACGGTGGAGGAGCAGGTGGTCTGGGTGTCGGAGATCTTAAGTACCAC 180


4555R-1.IR_full       181 AAGAAGGACAAGAATAAGGGAAAGCCACTTGATTCGGATGTCAAGCGACAGCCCTTCCTA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4555R-1.in silico     181 AAGAAGGACAAGAATAAGGGAAAGCCACTTGATTCGGATGTCAAGCGACAGCCCTTCCTA 240


4555R-1.IR_full       241 AGCAAACTGGGCATGCTGCAAAAGTACTGGTCCACCAACAAGACTGAGCTGATGCCGCAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4555R-1.in silico     241 AGCAAACTGGGCATGCTGCAAAAGTACTGGTCCACCAACAAGACTGAGCTGATGCCGCAG 300


4555R-1.IR_full       301 CTGGAGGAGATGGAGCAGGAGGTGGGCAACCTGCAGGCGGCACAGGCCAAGCAAGTGGTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4555R-1.in silico     301 CTGGAGGAGATGGAGCAGGAGGTGGGCAACCTGCAGGCGGCACAGGCCAAGCAAGTGGTG 360


4555R-1.IR_full       361 GCCGAGGAGGAGCTCGTGAAGCTCAACCAGCGCAGCGCCCTAATTGCCGAAATCAAATCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4555R-1.in silico     361 GCCGAGGAGGAGCTCGTGAAGCTCAACCAGCGCAGCGCCCTAATTGCCGAAATCAAATCG 420


4555R-1.IR_full       421 CTGGGCACGGCGATCGAGAGCCATAGTTTCAATACTGCCTCGCTGCGTAATGCCGTTCGT 480
                          ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
4555R-1.in silico     421 CTGGGCACGGCGATCGAGAGCCATAGTTTCAATACGGCCTCGCTGCGTAATGCCGTTCGT 480


4555R-1.IR_full       481 CGTGGTCACTCGGAGGCACT 500
                          ||||||||||||||||||||
4555R-1.in silico     481 CGTGGTCACTCGGAGGCACT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  13  NM_167095.1  CG32743-RA (Smg1), mRNA 
1.03   NM_130506.1  CG13358-RA (CG13358), mRNA 
0.41   NM_140284.1  CG6793-RA (CG6793), mRNA 
0.41   NM_164682.1  CG31641-RC, transcript variant C (stai), mRNA 
0.41   NM_164683.1  CG31641-RB, transcript variant B (stai), mRNA 
0.2   NM_001038952.1  CG33975-RA (CG33975), mRNA 
0.2   NM_168278.1  CG32352-RB, transcript variant B (CG32352), mRNA 
0.2   NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
0.2   NM_168279.2  CG32352-RA, transcript variant A (CG32352), mRNA 
0.2   NM_142016.1  CG8773-RA (CG8773), mRNA 
0.2   NM_137798.2  CG11061-RA, transcript variant A (GM130), mRNA 
0   NM_140044.1  CG4446-RA, transcript variant A (CG4446), mRNA 
0   NM_164977.1  CG6686-RA, transcript variant A (CG6686), mRNA 
0   NM_138097.2  CG3548-RA (CG3548), mRNA 
0   NM_135685.2  CG6686-RB, transcript variant B (CG6686), mRNA 
0   NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   NM_132855.2  CG9038-RA, transcript variant A (UBL3), mRNA 
0   NM_206730.1  CG9038-RB, transcript variant B (UBL3), mRNA 
0   11  NM_143061.1  CG13648-RA (tnc), mRNA 
0   NM_057539.3  CG9310-RA, transcript variant A (Hnf4), mRNA 
0   23  NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 
0   16  NM_169654.2  CG31302-RC, transcript variant C (CG31302), mRNA 
0   16  NM_169652.2  CG31302-RA, transcript variant A (CG31302), mRNA 
0   16  NM_169653.2  CG31302-RB, transcript variant B (CG31302), mRNA 
0   11  NM_164453.3  CG7254-RA, transcript variant A (GlyP), mRNA 
0   11  NM_001032048.1  CG7254-RB, transcript variant B (GlyP), mRNA 
0   11  NM_143223.1  CG14238-RA (CG14238), mRNA 
0   NM_140602.1  CG13050-RA (CG13050), mRNA 
0   NM_165685.1  CG30338-RA (CG30338), mRNA 
0   NM_132093.2  CG3367-RA (CG3367), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.