National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4552R-1 
 Symbol CG4552  Full Name CG4552 
 CG No CG4552  Old CG No CG4552 
 Synonyms CG4552 
 Accession No (Link to NCBI) NM_134725.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACATCTACGGCATATGCCAG 
 Primer Seq. 3'
aatctagaggtaccAACCAGGTCAGCGAGTACAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GACATCTACG GCATATGCCA GGGCAAGCGC TCTgCCGGAG GCNCTGCGTC CGGACGTGTG 
0061 GCAAGTGTGC CTGGATGTGC GCCACAAATC GGATCAAATG TCGCTCTTCA ACGAGATCTA 
0121 CGACCTGCCC TTCCAAAGCC AACTGCGCGA GGATTGCCAG CGGCACGTCG ATCGCATGGG 
0181 CAACGATGAG GAGGACAAGG TCTCGGTGGT ATCCGACCTC GAGTCCTATC ATCACCTTNT 
0241 ACTGCAAGAA CAGAAACCTT CAGTATGAGC CGGACAACGG ATGGATTGAA CTNGCTgCTC 
0301 CCNCTGTTCG CCCTGAAGCT GAATCGCTCC GACACATTCA ACCTGTTCGA GTCCATACGA 
0361 GACACGTACA TAcCCAAGGG TTGCNGGNCC AAGGGCAATG TCTTTCATgT CTTCCGACTG 
0421 CTCCTGCTTT ACCACGATCC GGAGCTGTGC ACGCTGCTGG ACACCAAGAA GATCACGCCC 
0481 GACTTGTACT CGCTGACCTG GTT 
 in silico PCR Fragment
0001 GACATCTACG GCATATGCCA GGGCAAG-GC TCTGCCGGAG GCACTGCGTC CGGACGTGTG 
0061 GCAAGTGTGC CTGGATGTGC GCCACAAATC GGATCAAATG TCGCTCTTCA ACGAGATCTA 
0121 CGACCTGCCC TTCCAAAGCC AACTGCGCGA GGATTGCCAG CGGCACGTCG ATCGCATGGG 
0181 CAACGATGAG GAGGACAAGG TCTCGGTGGT ATCCGACCTC GAGTCC-ATC ATCACCTTCT 
0241 ACTGCAAGAA CAGAAACCTT CAGTATGAGC CGGACAACGG ATGGATTGAA -TTGCTGCTC 
0301 CCGCTGTTCG CCCTGAAGCT GAATCGCTCC GACACATTCA ACCTGTTCGA GTCCATACGA 
0361 GACACGTACA TACCCAAGGG TTGCCGGCCC AAGGGCAATG TCTTTCATGT CTTCCGACTG 
0421 CTCCTGCTTT ACCACGATCC GGAGCTGTGC ACGCTGCTGG ACACCAAGAA GATCACGCCC 
0481 GACTTGTACT CGCTGACCTG GTT 
 Assemble Data

4552R-1.IR_full       1   GACATCTACGGCATATGCCAGGGCAAGCGCTCTGCCGGAGGCNCTGCGTCCGGACGTGTG 60
                          ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||
4552R-1.in silico     1   GACATCTACGGCATATGCCAGGGCAAG-GCTCTGCCGGAGGCACTGCGTCCGGACGTGTG 60


4552R-1.IR_full       61  GCAAGTGTGCCTGGATGTGCGCCACAAATCGGATCAAATGTCGCTCTTCAACGAGATCTA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4552R-1.in silico     61  GCAAGTGTGCCTGGATGTGCGCCACAAATCGGATCAAATGTCGCTCTTCAACGAGATCTA 120


4552R-1.IR_full       121 CGACCTGCCCTTCCAAAGCCAACTGCGCGAGGATTGCCAGCGGCACGTCGATCGCATGGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4552R-1.in silico     121 CGACCTGCCCTTCCAAAGCCAACTGCGCGAGGATTGCCAGCGGCACGTCGATCGCATGGG 180


4552R-1.IR_full       181 CAACGATGAGGAGGACAAGGTCTCGGTGGTATCCGACCTCGAGTCCTATCATCACCTTNT 240
                          |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
4552R-1.in silico     181 CAACGATGAGGAGGACAAGGTCTCGGTGGTATCCGACCTCGAGTCC-ATCATCACCTTCT 240


4552R-1.IR_full       241 ACTGCAAGAACAGAAACCTTCAGTATGAGCCGGACAACGGATGGATTGAACTNGCTGCTC 300
                          |||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||
4552R-1.in silico     241 ACTGCAAGAACAGAAACCTTCAGTATGAGCCGGACAACGGATGGATTGAA-TTGCTGCTC 300


4552R-1.IR_full       301 CCNCTGTTCGCCCTGAAGCTGAATCGCTCCGACACATTCAACCTGTTCGAGTCCATACGA 360
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4552R-1.in silico     301 CCGCTGTTCGCCCTGAAGCTGAATCGCTCCGACACATTCAACCTGTTCGAGTCCATACGA 360


4552R-1.IR_full       361 GACACGTACATACCCAAGGGTTGCNGGNCCAAGGGCAATGTCTTTCATGTCTTCCGACTG 420
                          |||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||
4552R-1.in silico     361 GACACGTACATACCCAAGGGTTGCCGGCCCAAGGGCAATGTCTTTCATGTCTTCCGACTG 420


4552R-1.IR_full       421 CTCCTGCTTTACCACGATCCGGAGCTGTGCACGCTGCTGGACACCAAGAAGATCACGCCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4552R-1.in silico     421 CTCCTGCTTTACCACGATCCGGAGCTGTGCACGCTGCTGGACACCAAGAAGATCACGCCC 480


4552R-1.IR_full       481 GACTTGTACTCGCTGACCTGGTT 503
                          |||||||||||||||||||||||
4552R-1.in silico     481 GACTTGTACTCGCTGACCTGGTT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134725.1  CG4552-RA (CG4552), mRNA 
0.41   NM_130675.1  CG14416-RA (CG14416), mRNA 
0.2   NM_138253.2  CG9186-RB, transcript variant B (CG9186), mRNA 
0.2   NM_167867.1  CG9186-RA, transcript variant A (CG9186), mRNA 
0   NM_078558.2  CG2155-RA (v), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_138052.2  CG3356-RA (CG3356), mRNA 
0   NM_170546.1  CG31005-RA (CG31005), mRNA 
0   NM_138031.1  CG3173-RA (CG3173), mRNA 
0   NM_140681.3  CG9665-RA (CG9665), mRNA 
0   NM_078566.3  CG12622-RA (Gr10b), mRNA 
0   NM_136976.1  CG17577-RA (Cyp9h1), mRNA 
0   NM_164539.1  CG31956-RA (pgant4), mRNA 
0   NM_167418.1  CG9517-RB, transcript variant B (CG9517), mRNA 
0   NM_132752.2  CG9517-RA, transcript variant A (CG9517), mRNA 
0   NM_140649.2  CG17286-RA (CG17286), mRNA 
0   NM_166055.1  CG10108-RA (phyl), mRNA 
0   NM_136977.2  CG17575-RA (CG17575), mRNA 
0   NM_132305.1  CG12115-RA (CG12115), mRNA 
0   NM_164582.1  CG3054-RA, transcript variant A (l(2)k05819), mRNA 
0   NM_134985.2  CG3054-RB, transcript variant B (l(2)k05819), mRNA 
0   NM_168064.2  CG14998-RA, transcript variant A (CG14998), mRNA 
0   NM_168063.2  CG14998-RD, transcript variant D (CG14998), mRNA 
0   NM_168062.2  CG14998-RE, transcript variant E (CG14998), mRNA 
0   NM_168061.2  CG14998-RB, transcript variant B (CG14998), mRNA 
0   NM_139604.2  CG14998-RC, transcript variant C (CG14998), mRNA 
0   NM_136168.1  CG10662-RA (sick), mRNA 
0   NM_141280.2  CG14669-RA (CG14669), mRNA 
0   NM_140866.1  CG9299-RA (CG9299), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.