National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4552R-1 
 Symbol CG4552  Full Name CG4552 
 CG No CG4552  Old CG No CG4552 
 Synonyms CG4552 
 Accession No (Link to NCBI) NM_134725.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| silico     1   GACATCTACGGCATATGCCAGGGCAAG-GCTCTGCCGGAGGCACTGCGTCCGGACGTGTG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCAAGTGTGCCTGGATGTGCGCCACAAATCGGATCAAATGTCGCTCTTCAACGAGATCTA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGACCTGCCCTTCCAAAGCCAACTGCGCGAGGATTGCCAGCGGCACGTCGATCGCATGGG 180

                          |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | silico     181 CAACGATGAGGAGGACAAGGTCTCGGTGGTATCCGACCTCGAGTCC-ATCATCACCTTCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| silico     241 ACTGCAAGAACAGAAACCTTCAGTATGAGCCGGACAACGGATGGATTGAA-TTGCTGCTC 300

                          || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCGCTGTTCGCCCTGAAGCTGAATCGCTCCGACACATTCAACCTGTTCGAGTCCATACGA 360

                          |||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| silico     361 GACACGTACATACCCAAGGGTTGCCGGCCCAAGGGCAATGTCTTTCATGTCTTCCGACTG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTCCTGCTTTACCACGATCCGGAGCTGTGCACGCTGCTGGACACCAAGAAGATCACGCCC 480

4552R-1.IR_full       481 GACTTGTACTCGCTGACCTGGTT 503
                          ||||||||||||||||||||||| silico     481 GACTTGTACTCGCTGACCTGGTT 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134725.1  CG4552-RA (CG4552), mRNA 
0.41   NM_130675.1  CG14416-RA (CG14416), mRNA 
0.2   NM_138253.2  CG9186-RB, transcript variant B (CG9186), mRNA 
0.2   NM_167867.1  CG9186-RA, transcript variant A (CG9186), mRNA 
0   NM_078558.2  CG2155-RA (v), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_138052.2  CG3356-RA (CG3356), mRNA 
0   NM_170546.1  CG31005-RA (CG31005), mRNA 
0   NM_138031.1  CG3173-RA (CG3173), mRNA 
0   NM_140681.3  CG9665-RA (CG9665), mRNA 
0   NM_078566.3  CG12622-RA (Gr10b), mRNA 
0   NM_136976.1  CG17577-RA (Cyp9h1), mRNA 
0   NM_164539.1  CG31956-RA (pgant4), mRNA 
0   NM_167418.1  CG9517-RB, transcript variant B (CG9517), mRNA 
0   NM_132752.2  CG9517-RA, transcript variant A (CG9517), mRNA 
0   NM_140649.2  CG17286-RA (CG17286), mRNA 
0   NM_166055.1  CG10108-RA (phyl), mRNA 
0   NM_136977.2  CG17575-RA (CG17575), mRNA 
0   NM_132305.1  CG12115-RA (CG12115), mRNA 
0   NM_164582.1  CG3054-RA, transcript variant A (l(2)k05819), mRNA 
0   NM_134985.2  CG3054-RB, transcript variant B (l(2)k05819), mRNA 
0   NM_168064.2  CG14998-RA, transcript variant A (CG14998), mRNA 
0   NM_168063.2  CG14998-RD, transcript variant D (CG14998), mRNA 
0   NM_168062.2  CG14998-RE, transcript variant E (CG14998), mRNA 
0   NM_168061.2  CG14998-RB, transcript variant B (CG14998), mRNA 
0   NM_139604.2  CG14998-RC, transcript variant C (CG14998), mRNA 
0   NM_136168.1  CG10662-RA (sick), mRNA 
0   NM_141280.2  CG14669-RA (CG14669), mRNA 
0   NM_140866.1  CG9299-RA (CG9299), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.