National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4551R-3 
 Symbol smi35A  Full Name smell impaired 35A 
 CG No CG4551  Old CG No CG4551 
 Synonyms dDYRK2, CG4551, Dyrk2, DYRK, DYRK2, BG:DS01523.3, smi35A 
 Accession No (Link to NCBI) NM_078840.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATGCGAAATGCCGATCCAGC 
 Primer Seq. 3'
aatctagaggtaccGGGGGCGGGTTTGTTGTAGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NATGCGAAAT GCCGATCCAG CTGGACAACG AGAAGTTGCG GCGGGATGTT CGATTGTCGG 
0061 GCTCTCGACT TGATTTGCCA CAACTCTGTA ATGGATCCCG TCGGTTGGAT GGCCACAACA 
0121 ACCATGTGGC TGCCAATGAG AACACGGTTA CAACGACATC CCTGAATGGA AATGGCAACG 
0181 GCAATGGCAA TAGCAATAGC AACAACAACA ACAACATCGG ATCGCCCGTC TCCTCATCGA 
0241 CAACAAACAG CAGTAATGGC GGCAACGAGC GCGGCTCCTC CACAAAGTCC AATAGCAGCA 
0301 GTGGAAGTGG CAGCTCGGGA AACTCGGCCA GCAGCACGGG AAGTGGCGAG CTCAAATACA 
0361 ATACGCCCAT GACGCCATCT GAGCTGGTGA AGAAGTTCCG CAAACTACCT AACCGATCTT 
0421 GAGTTCGAAG AGCTCAAGGT GTACAAGGAA GTGTGGTATT TTGGCCAGCA CGCCAGCAAG 
0481 AACTACAACA AANCCCGCCC Cc 
 in silico PCR Fragment
0001 GATGCGAAAT GCCGATCCAG CTGGACAACG AGAAGTTGCG GCGGGATGTT CGATTGTCGG 
0061 GCTCTCGACT TGATTTGCCA CAACTCTGTA ATGGATCCCG TCGGTTGGAT GGCCACAACA 
0121 ACCATGTGGC TGCCAATGAG AACACGGTTA CAACGACATC CCTGAATGGA AATGGCAACG 
0181 GCAATGGCAA TAGCAATAGC AACAACAACA ACAACATCGG ATCGCCCGTC TCCTCATCGA 
0241 CAACAAACAG CAGTAATGGC GGCAACGAGC GCGGCTCCTC CACAAAGTCC AATAGCAGCA 
0301 GTGGAAGTGG CAGCTCGGGA AACTCGGCCA GCAGCACGGG AAGTGGCGAG CTCAAATGCA 
0361 ATACGCCCAT GACGCCATCT GAGCTGGTGA AGAAGTTCCG C-AACTACCT AACCGATCTT 
0421 GAGTTCGAAG AGCTCAAGGT GTACAAGGAA GTGTGGTATT TTGGCCAGCA CGCCAGCAAG 
0481 AACTACAACA AA-CCCGCCC CC 
 Assemble Data

4551R-3.IR_full        1   ATGCGAAATGCCGATCCAGCTGGACAACGAGAAGTTGCGGCGGGATGTTCGATTGTCGG 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4551R-3.in silico      1   ATGCGAAATGCCGATCCAGCTGGACAACGAGAAGTTGCGGCGGGATGTTCGATTGTCGG 59


4551R-3.IR_full       61  GCTCTCGACTTGATTTGCCACAACTCTGTAATGGATCCCGTCGGTTGGATGGCCACAACA 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4551R-3.in silico     61  GCTCTCGACTTGATTTGCCACAACTCTGTAATGGATCCCGTCGGTTGGATGGCCACAACA 119


4551R-3.IR_full       121 ACCATGTGGCTGCCAATGAGAACACGGTTACAACGACATCCCTGAATGGAAATGGCAACG 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4551R-3.in silico     121 ACCATGTGGCTGCCAATGAGAACACGGTTACAACGACATCCCTGAATGGAAATGGCAACG 179


4551R-3.IR_full       181 GCAATGGCAATAGCAATAGCAACAACAACAACAACATCGGATCGCCCGTCTCCTCATCGA 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4551R-3.in silico     181 GCAATGGCAATAGCAATAGCAACAACAACAACAACATCGGATCGCCCGTCTCCTCATCGA 239


4551R-3.IR_full       241 CAACAAACAGCAGTAATGGCGGCAACGAGCGCGGCTCCTCCACAAAGTCCAATAGCAGCA 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4551R-3.in silico     241 CAACAAACAGCAGTAATGGCGGCAACGAGCGCGGCTCCTCCACAAAGTCCAATAGCAGCA 299


4551R-3.IR_full       301 GTGGAAGTGGCAGCTCGGGAAACTCGGCCAGCAGCACGGGAAGTGGCGAGCTCAAATACA 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
4551R-3.in silico     301 GTGGAAGTGGCAGCTCGGGAAACTCGGCCAGCAGCACGGGAAGTGGCGAGCTCAAATGCA 359


4551R-3.IR_full       361 ATACGCCCATGACGCCATCTGAGCTGGTGAAGAAGTTCCGCAAACTACCTAACCGATCTT 419
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
4551R-3.in silico     361 ATACGCCCATGACGCCATCTGAGCTGGTGAAGAAGTTCCGC-AACTACCTAACCGATCTT 419


4551R-3.IR_full       421 GAGTTCGAAGAGCTCAAGGTGTACAAGGAAGTGTGGTATTTTGGCCAGCACGCCAGCAAG 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4551R-3.in silico     421 GAGTTCGAAGAGCTCAAGGTGTACAAGGAAGTGTGGTATTTTGGCCAGCACGCCAGCAAG 479


4551R-3.IR_full       481 AACTACAACAAANCCCGCCCCC 501
                          |||||||||||| |||||||||
4551R-3.in silico     481 AACTACAACAAA-CCCGCCCCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  24  44  NM_205989.2  CG4551-RB, transcript variant B (smi35A), mRNA 
100   482  24  44  NM_078840.4  CG4551-RA, transcript variant A (smi35A), mRNA 
100   482  24  44  NM_205988.2  CG4551-RC, transcript variant C (smi35A), mRNA 
100   482  24  44  NM_001038818.1  CG4551-RE, transcript variant E (smi35A), mRNA 
100   482  24  44  NM_001038817.1  CG4551-RD, transcript variant D (smi35A), mRNA 
1.45   20  111  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
1.45   20  111  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
1.45   14  49  NM_206109.1  CG8118-RC, transcript variant C (mam), mRNA 
1.24   37  NM_142356.2  CG4135-RA (beat-IIb), mRNA 
1.03   13  55  100  NM_136854.1  CG13194-RA (pyr), mRNA 
0.82   23  54  NM_169170.1  CG1070-RC, transcript variant C (Alh), mRNA 
0.82   10  28  NM_169172.1  CG1070-RB, transcript variant B (Alh), mRNA 
0.62   25  74  184  NM_078592.2  CG11172-RA (NFAT), mRNA 
0.62   12  33  85  NM_166896.1  CG11491-RB, transcript variant B (br), mRNA 
0.62   12  33  85  NM_166897.1  CG11491-RC, transcript variant C (br), mRNA 
0.62   20  40  NM_167017.1  CG7010-RC, transcript variant C (l(1)G0334), mRNA 
0.62   20  40  NM_167019.1  CG7010-RB, transcript variant B (l(1)G0334), mRNA 
0.62   17  NM_176506.2  CG6963-RE, transcript variant E (gish), mRNA 
0.62   17  NM_169713.3  CG6963-RD, transcript variant D (gish), mRNA 
0.62   17  NM_001014626.1  CG6963-RH, transcript variant H (gish), mRNA 
0.62   17  NM_169712.2  CG6963-RB, transcript variant B (gish), mRNA 
0.62   16  NM_001014628.1  CG6963-RF, transcript variant F (gish), mRNA 
0.62   NM_132575.2  CG2560-RA (CG2560), mRNA 
0.41   37  143  256  NM_168571.2  CG32133-RA (CG32133), mRNA 
0.41   24  63  199  NM_132370.1  CG2989-RA (CG2989), mRNA 
0.41   15  37  85  NM_130677.1  CG14418-RA (CG14418), mRNA 
0.41   14  41  65  NM_132161.4  CG1659-RA (unc-119), mRNA 
0.41   10  40  92  NM_206357.2  CG33261-RD, transcript variant D (Trl), mRNA 
0.41   10  40  92  NM_206358.2  CG33261-RA, transcript variant A (Trl), mRNA 
0.41   10  40  92  NM_206360.1  CG33261-RF, transcript variant F (Trl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.