National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4551R-1 
 Symbol smi35A  Full Name smell impaired 35A 
 CG No CG4551  Old CG No CG4551 
 Synonyms dDYRK2, CG4551, Dyrk2, DYRK, DYRK2, BG:DS01523.3, smi35A 
 Accession No (Link to NCBI) NM_078840.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   ATGCGAAATGCCGATCCAGCTGGACAACGAGAAGTTGCGGCGGGATGTTCGATTGTCGG 59

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCTCTCGACTTGATTTGCCACAACTCTGTAATGGATCCCGTCGGTTGGATGGCCACAACA 119

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACCATGTGGCTGCCAATGAGAACACGGTTACAACGACATCCCTGAATGGAAATGGCAACG 179

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCAATGGCAATAGCAATAGCAACAACAACAACAACATCGGATCGCCCGTCTCCTCATCGA 239

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAACAAACAGCAGTAATGGCGGCAACGAGCGCGGCTCCTCCACAAAGTCCAATAGCAGCA 299

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     301 GTGGAAGTGGCAGCTCGGGAAACTCGGCCAGCAGCACGGGAAGTGGCGAGCTCAAATGCA 359

                          ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| silico     361 ATACGCCCATGACGCCATCTGAGCTGGTGAAGAAGTTCCGC-AACTACCTAACCGATCTT 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAGTTCGAAGAGCTCAAGGTGTACAAGGAAGTGTGGTATTTTGGCCAGCACGCCAGCAAG 479

4551R-1.IR_full       481 AACTACAACAAANCCCGCCCCC 501
                          |||||||||||| ||||||||| silico     481 AACTACAACAAA-CCCGCCCCC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  24  44  NM_205989.2  CG4551-RB, transcript variant B (smi35A), mRNA 
100   482  24  44  NM_078840.4  CG4551-RA, transcript variant A (smi35A), mRNA 
100   482  24  44  NM_205988.2  CG4551-RC, transcript variant C (smi35A), mRNA 
100   482  24  44  NM_001038818.1  CG4551-RE, transcript variant E (smi35A), mRNA 
100   482  24  44  NM_001038817.1  CG4551-RD, transcript variant D (smi35A), mRNA 
1.45   20  111  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
1.45   20  111  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
1.45   14  49  NM_206109.1  CG8118-RC, transcript variant C (mam), mRNA 
1.24   37  NM_142356.2  CG4135-RA (beat-IIb), mRNA 
1.03   13  55  100  NM_136854.1  CG13194-RA (pyr), mRNA 
0.82   23  54  NM_169170.1  CG1070-RC, transcript variant C (Alh), mRNA 
0.82   10  28  NM_169172.1  CG1070-RB, transcript variant B (Alh), mRNA 
0.62   25  74  184  NM_078592.2  CG11172-RA (NFAT), mRNA 
0.62   12  33  85  NM_166896.1  CG11491-RB, transcript variant B (br), mRNA 
0.62   12  33  85  NM_166897.1  CG11491-RC, transcript variant C (br), mRNA 
0.62   20  40  NM_167017.1  CG7010-RC, transcript variant C (l(1)G0334), mRNA 
0.62   20  40  NM_167019.1  CG7010-RB, transcript variant B (l(1)G0334), mRNA 
0.62   17  NM_176506.2  CG6963-RE, transcript variant E (gish), mRNA 
0.62   17  NM_169713.3  CG6963-RD, transcript variant D (gish), mRNA 
0.62   17  NM_001014626.1  CG6963-RH, transcript variant H (gish), mRNA 
0.62   17  NM_169712.2  CG6963-RB, transcript variant B (gish), mRNA 
0.62   16  NM_001014628.1  CG6963-RF, transcript variant F (gish), mRNA 
0.62   NM_132575.2  CG2560-RA (CG2560), mRNA 
0.41   37  143  256  NM_168571.2  CG32133-RA (CG32133), mRNA 
0.41   24  63  199  NM_132370.1  CG2989-RA (CG2989), mRNA 
0.41   15  37  85  NM_130677.1  CG14418-RA (CG14418), mRNA 
0.41   14  41  65  NM_132161.4  CG1659-RA (unc-119), mRNA 
0.41   10  40  92  NM_206357.2  CG33261-RD, transcript variant D (Trl), mRNA 
0.41   10  40  92  NM_206358.2  CG33261-RA, transcript variant A (Trl), mRNA 
0.41   10  40  92  NM_206360.1  CG33261-RF, transcript variant F (Trl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.