National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4549R-2 
 Symbol Smg1  Full Name Smg1 
 CG No CG32743  Old CG No CG4549 
 Synonyms smg1, rst(1a)cyr, CG4555, CG4549, CG32743, SMG1, clone 1.24, anon-EST:Liang-1.24, anon-WO0170980.133, Smg1 
 Accession No (Link to NCBI) NM_167095.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Read RD, Fenton TR, Gomez GG, Wykosky J, Vandenberg SR, Babic I, Iwanami A, Yang H, Cavenee WK, Mischel PS, Furnari FB, Thomas JB.
A kinome-wide RNAi screen in Drosophila Glia reveals that the RIO kinases mediate cell proliferation and survival through TORC2-Akt signaling in glioblastoma.
PLoS Genet. (2013) 9(2) e1003253 [ PubMed ID = 23459592 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCGTTCCACGCGGAAATTGACCGCGTTCTGCTGAACAACAATGGCAATCACGGTGACAGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     61  AGCAACGAAGGCGGCGGTGGTAATGGCAGCGGGAGGGGTGGCGCCACCGG-AAGCGGCAA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TATCGCCGGCTTGGGAGGCAGTGAATCCATGTGGTCACCTGGTGGTGGTAAGTCGCACGA 180

                          ||||||||||  ||||||||||||||| |||||||||||||||||||||||||||||||| silico     181 CGTTGCGCAGGCGTTCGCCAACGCACT-GCTGCTGCGCAACATGAACCATGTTGTGGGCA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAGGGCAGCCAGTGGTCCAAAATCACCGAAAGGCTTACCAATGCAAAGGCGATACGATCA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACCCGATGGCCAATGGCGAAGATCTGCGTCTGTCCAAGATCATCCGCAGGCTAATCAACG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGAACAATCCCACCGTGTCTCTGGAGCTGTGCAGCAAACTGGATCAAGCAGTGCGCACGC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTATCAACATGGGCTACATGACATGCTCCTTCGTGTGGATTCTGGACAACATGCTCACCC 480

4549R-2.IR_full       481 TATACAAGCAATGCCCGCCNCC 502
                          ||||||||||||||||||| || silico     481 TATACAAGCAATGCCCGCCGCC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167095.1  CG32743-RA (Smg1), mRNA 
0.2   NM_132704.1  CG11071-RA (CG11071), mRNA 
0   NM_079283.3  CG14176-RB (Or67b), mRNA 
0   NM_001043265.1  CG34139-RA (CG34139), mRNA 
0   NM_078844.2  CG3688-RA (l(2)35Bd), mRNA 
0   NM_136017.2  CG15151-RA (PFE), mRNA 
0   NM_142271.2  CG6126-RA (CG6126), mRNA 
0   NM_058118.3  CG18783-RB, transcript variant B (Kr-h1), mRNA 
0   NM_058119.3  CG18783-RA, transcript variant A (Kr-h1), mRNA 
0   NM_137718.2  CG9480-RA, transcript variant A (Glycogenin), mRNA 
0   NM_167316.1  CG1803-RD, transcript variant D (regucalcin), mRNA 
0   NM_167315.1  CG1803-RB, transcript variant B (regucalcin), mRNA 
0   NM_132547.2  CG1803-RC, transcript variant C (regucalcin), mRNA 
0   NM_167314.1  CG1803-RA, transcript variant A (regucalcin), mRNA 
0   NM_079509.1  CG2666-RA, transcript variant A (kkv), mRNA 
0   NM_206430.1  CG2666-RC, transcript variant C (kkv), mRNA 
0   NM_169052.1  CG2666-RB, transcript variant B (kkv), mRNA 
0   NM_140438.2  CG32139-RA (Sox21b), mRNA 
0   NM_140036.1  CG4476-RB (CG4476), mRNA 
0   NM_079354.3  CG17871-RB (Or71a), mRNA 
0   NM_130725.2  CG15239-RA (CG15239), mRNA 
0   NM_134899.2  CG17259-RA (CG17259), mRNA 
0   NM_132922.2  CG4653-RA (CG4653), mRNA 
0   NM_142706.2  CG3308-RA (CG3308), mRNA 
0   NM_136209.2  CG9318-RA (CG9318), mRNA 
0   NM_141503.2  CG2702-RA (CG2702), mRNA 
0   NM_079155.2  CG9102-RA (bab2), mRNA 
0   NM_078868.2  CG5545-RA (Oli), mRNA 
0   11  NM_142959.2  CG6129-RB, transcript variant B (CG6129), mRNA 
0   NM_132384.2  CG2962-RA (CG2962), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.