National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4549R-1 
 Symbol Smg1  Full Name Smg1 
 CG No CG32743  Old CG No CG4549 
 Synonyms smg1, rst(1a)cyr, CG4555, CG4549, CG32743, SMG1, clone 1.24, anon-EST:Liang-1.24, anon-WO0170980.133, Smg1 
 Accession No (Link to NCBI) NM_167095.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Parsons LM, Grzeschik NA, Amaratunga K, Burke P, Quinn LM, Richardson HE.
A Kinome RNAi Screen in Drosophila Identifies Novel Genes Interacting with Lgl, aPKC, and Crb Cell Polarity Genes in Epithelial Tissues.
G3 (Bethesda) (2017) 7(8) 2497-2509 [ PubMed ID = 28611255 ] [ RRC reference ]

Read RD, Fenton TR, Gomez GG, Wykosky J, Vandenberg SR, Babic I, Iwanami A, Yang H, Cavenee WK, Mischel PS, Furnari FB, Thomas JB.
A kinome-wide RNAi screen in Drosophila Glia reveals that the RIO kinases mediate cell proliferation and survival through TORC2-Akt signaling in glioblastoma.
PLoS Genet. (2013) 9(2) e1003253 [ PubMed ID = 23459592 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGTTCCACGCGGAAATTGAC 
 Primer Seq. 3'
aatctagaggtaccGGCGGCGGGCATTGCTTGTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCGTTCCACG cGGAAATTGA CCGCGTTCTG CTGAACAACA ATGGCAATCA CGGTGACAGC 
0061 AGCAACGAAG GCGGCGGTGG TAATGGCAGC GGGAGGGGTG GCGCCACCGG NAAGCGGCAA 
0121 TATCGCCGGC TTGGGAGGCA GTGAATCCAT GTGGTCACCT GGTGGTGGTA AGTCGCACGA 
0181 CGTTGCGCAG NNGTTCGCCA ACGCACTNGC TGCTGCGCAA CATGAACCAT GTTGTGGGCA 
0241 AAGGGCAGCC AGTGGTCCAA AATCACCGAA AGGCTTACCA ATGCAAAGGC GATACGATCA 
0301 ACCCGATGGC CAATGGCGAA GATCTGCGTC TGTCCAAGAT CATCCGCAGG CTAATCAACG 
0361 AGAACAATCC CACCGTGTCT CTGGAGCTGT GCAGCAAACT GGATCAAGCA GTGCGCACGC 
0421 CTATCAACAT GGGCTACATG ACATGCTCCT TCGTGTGGAT TCTGGACAAC ATGCTCACCC 
0481 TATACAAGCA ATGCCCgCCN Cc 
 in silico PCR Fragment
0001 GCGTTCCACG CGGAAATTGA CCGCGTTCTG CTGAACAACA ATGGCAATCA CGGTGACAGC 
0061 AGCAACGAAG GCGGCGGTGG TAATGGCAGC GGGAGGGGTG GCGCCACCGG -AAGCGGCAA 
0121 TATCGCCGGC TTGGGAGGCA GTGAATCCAT GTGGTCACCT GGTGGTGGTA AGTCGCACGA 
0181 CGTTGCGCAG GCGTTCGCCA ACGCACT-GC TGCTGCGCAA CATGAACCAT GTTGTGGGCA 
0241 AAGGGCAGCC AGTGGTCCAA AATCACCGAA AGGCTTACCA ATGCAAAGGC GATACGATCA 
0301 ACCCGATGGC CAATGGCGAA GATCTGCGTC TGTCCAAGAT CATCCGCAGG CTAATCAACG 
0361 AGAACAATCC CACCGTGTCT CTGGAGCTGT GCAGCAAACT GGATCAAGCA GTGCGCACGC 
0421 CTATCAACAT GGGCTACATG ACATGCTCCT TCGTGTGGAT TCTGGACAAC ATGCTCACCC 
0481 TATACAAGCA ATGCCCGCCG CC 
 Assemble Data

4549R-1.IR_full       1   GCGTTCCACGCGGAAATTGACCGCGTTCTGCTGAACAACAATGGCAATCACGGTGACAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4549R-1.in silico     1   GCGTTCCACGCGGAAATTGACCGCGTTCTGCTGAACAACAATGGCAATCACGGTGACAGC 60


4549R-1.IR_full       61  AGCAACGAAGGCGGCGGTGGTAATGGCAGCGGGAGGGGTGGCGCCACCGGNAAGCGGCAA 120
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
4549R-1.in silico     61  AGCAACGAAGGCGGCGGTGGTAATGGCAGCGGGAGGGGTGGCGCCACCGG-AAGCGGCAA 120


4549R-1.IR_full       121 TATCGCCGGCTTGGGAGGCAGTGAATCCATGTGGTCACCTGGTGGTGGTAAGTCGCACGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4549R-1.in silico     121 TATCGCCGGCTTGGGAGGCAGTGAATCCATGTGGTCACCTGGTGGTGGTAAGTCGCACGA 180


4549R-1.IR_full       181 CGTTGCGCAGNNGTTCGCCAACGCACTNGCTGCTGCGCAACATGAACCATGTTGTGGGCA 240
                          ||||||||||  ||||||||||||||| ||||||||||||||||||||||||||||||||
4549R-1.in silico     181 CGTTGCGCAGGCGTTCGCCAACGCACT-GCTGCTGCGCAACATGAACCATGTTGTGGGCA 240


4549R-1.IR_full       241 AAGGGCAGCCAGTGGTCCAAAATCACCGAAAGGCTTACCAATGCAAAGGCGATACGATCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4549R-1.in silico     241 AAGGGCAGCCAGTGGTCCAAAATCACCGAAAGGCTTACCAATGCAAAGGCGATACGATCA 300


4549R-1.IR_full       301 ACCCGATGGCCAATGGCGAAGATCTGCGTCTGTCCAAGATCATCCGCAGGCTAATCAACG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4549R-1.in silico     301 ACCCGATGGCCAATGGCGAAGATCTGCGTCTGTCCAAGATCATCCGCAGGCTAATCAACG 360


4549R-1.IR_full       361 AGAACAATCCCACCGTGTCTCTGGAGCTGTGCAGCAAACTGGATCAAGCAGTGCGCACGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4549R-1.in silico     361 AGAACAATCCCACCGTGTCTCTGGAGCTGTGCAGCAAACTGGATCAAGCAGTGCGCACGC 420


4549R-1.IR_full       421 CTATCAACATGGGCTACATGACATGCTCCTTCGTGTGGATTCTGGACAACATGCTCACCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4549R-1.in silico     421 CTATCAACATGGGCTACATGACATGCTCCTTCGTGTGGATTCTGGACAACATGCTCACCC 480


4549R-1.IR_full       481 TATACAAGCAATGCCCGCCNCC 502
                          ||||||||||||||||||| ||
4549R-1.in silico     481 TATACAAGCAATGCCCGCCGCC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167095.1  CG32743-RA (Smg1), mRNA 
0.2   NM_132704.1  CG11071-RA (CG11071), mRNA 
0   NM_079283.3  CG14176-RB (Or67b), mRNA 
0   NM_001043265.1  CG34139-RA (CG34139), mRNA 
0   NM_078844.2  CG3688-RA (l(2)35Bd), mRNA 
0   NM_136017.2  CG15151-RA (PFE), mRNA 
0   NM_142271.2  CG6126-RA (CG6126), mRNA 
0   NM_058118.3  CG18783-RB, transcript variant B (Kr-h1), mRNA 
0   NM_058119.3  CG18783-RA, transcript variant A (Kr-h1), mRNA 
0   NM_137718.2  CG9480-RA, transcript variant A (Glycogenin), mRNA 
0   NM_167316.1  CG1803-RD, transcript variant D (regucalcin), mRNA 
0   NM_167315.1  CG1803-RB, transcript variant B (regucalcin), mRNA 
0   NM_132547.2  CG1803-RC, transcript variant C (regucalcin), mRNA 
0   NM_167314.1  CG1803-RA, transcript variant A (regucalcin), mRNA 
0   NM_079509.1  CG2666-RA, transcript variant A (kkv), mRNA 
0   NM_206430.1  CG2666-RC, transcript variant C (kkv), mRNA 
0   NM_169052.1  CG2666-RB, transcript variant B (kkv), mRNA 
0   NM_140438.2  CG32139-RA (Sox21b), mRNA 
0   NM_140036.1  CG4476-RB (CG4476), mRNA 
0   NM_079354.3  CG17871-RB (Or71a), mRNA 
0   NM_130725.2  CG15239-RA (CG15239), mRNA 
0   NM_134899.2  CG17259-RA (CG17259), mRNA 
0   NM_132922.2  CG4653-RA (CG4653), mRNA 
0   NM_142706.2  CG3308-RA (CG3308), mRNA 
0   NM_136209.2  CG9318-RA (CG9318), mRNA 
0   NM_141503.2  CG2702-RA (CG2702), mRNA 
0   NM_079155.2  CG9102-RA (bab2), mRNA 
0   NM_078868.2  CG5545-RA (Oli), mRNA 
0   11  NM_142959.2  CG6129-RB, transcript variant B (CG6129), mRNA 
0   NM_132384.2  CG2962-RA (CG2962), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.