National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4486R-1 
 Symbol Cyp9b2  Full Name Cytochrome P450-9b2 
 CG No CG4486  Old CG No CG4486 
 Synonyms cyp9b2, 9b2, P450, P-450, BEST:GH08116, CG4486, Cyp9b2 
 Accession No (Link to NCBI) NM_078922.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Dourlen P, Fernandez-Gomez FJ, Dupont C, Grenier-Boley B, Bellenguez C, Obriot H, Caillierez R, Sottejeau Y, Chapuis J, Bretteville A, Abdelfettah F, Delay C, Malmanche N, Soininen H, Hiltunen M, Galas MC, Amouyel P, Sergeant N, Buée L, Lambert JC, Dermaut B.
Functional screening of Alzheimer risk loci identifies PTK2B as an in vivo modulator and early marker of Tau pathology.
Mol. Psychiatry (2017) 22(6) 874-883 [ PubMed ID = 27113998 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTGTCTGGCCCTTGTGGTCA 
 Primer Seq. 3'
aatctagaggtaccCTTTCTGCCGGGAAGCGTTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTTGTCTGGC CCTTGTGGTC ATCGGTTATC TCATCTACAA ATGGAGCACG GCCACCTTCA 
0061 AAACCTTTGA GGAAAGGAAG CTCTACTTCG AAAAGCCATA TCCCTTTGTG GGTAATATGG 
0121 CTGCAGCGGC CTTGCAGAAG TCGTCCTTCC AGAGACAACT CACCGAGTTC TACGAACGCA 
0181 CTCGTCAACA CAAACTGGTG GGCTTCTTCA ATATGCGCAC ACCTATGATC ACGCTAAACG 
0241 ACCCGGAGCT GATCAAAAAG GTCTGCGTAA AGGACTTTGA CCACTTCCCC AACCACCAGC 
0301 CCTTCATCAC CTCCAACGAT CGCCTGTTCA ACGACATGCT CAGCGTGATG AGGGACCAGC 
0361 GGTGGAAGCA CATGAGAAAC ACCCTCACTC CGGTCTTCAC GGCGGCCAAA ATGCGCAACA 
0421 TGTTCACCCT GATGAACGAG AGCTTCGCGG AGTGCCTGCA GCACCTGGAC AGCTCTTCGA 
0481 AAACGCTTCC CGGCAGAAAG  
 in silico PCR Fragment
0001 TTTGTCTGGC CCTTGTGGTC ATCGGTTATC TCATCTACAA ATGGAGCACG GCCACCTTCA 
0061 AAACCTTTGA GGAAAGGAAG CTCTACTTCG AAAAGCCATA TCCCTTTGTG GGTAATATGG 
0121 CTGCAGCGGC CTTGCAGAAG TCGTCCTTCC AGAGACAACT CACCGAGTTC TACGAACGCA 
0181 CTCGTCAACA CAAACTGGTG GGCTTCTTCA ATATGCGCAC ACCTATGATC ACGCTAAACG 
0241 ACCCGGAGCT GATCAAAAAG GTCTGCGTAA AGGACTTTGA CCACTTCCCC AACCACCAGC 
0301 CCTTCATCAC CTCCAACGAT CGCCTGTTCA ACGACATGCT CAGCGTGATG AGGGACCAGC 
0361 GGTGGAAGCA CATGAGAAAC ACCCTCACTC CGGTCTTCAC GGCGGCCAAA ATGCGCAACA 
0421 TGTTCACCCT GATGAACGAG AGCTTCGCGG AGTGCCTGCA GCACCTGGAC AGCTCTTCGA 
0481 AAACGCTTCC CGGCAGAAAG  
 Assemble Data

4486R-1.IR_full       1   TTTGTCTGGCCCTTGTGGTCATCGGTTATCTCATCTACAAATGGAGCACGGCCACCTTCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4486R-1.in silico     1   TTTGTCTGGCCCTTGTGGTCATCGGTTATCTCATCTACAAATGGAGCACGGCCACCTTCA 60


4486R-1.IR_full       61  AAACCTTTGAGGAAAGGAAGCTCTACTTCGAAAAGCCATATCCCTTTGTGGGTAATATGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4486R-1.in silico     61  AAACCTTTGAGGAAAGGAAGCTCTACTTCGAAAAGCCATATCCCTTTGTGGGTAATATGG 120


4486R-1.IR_full       121 CTGCAGCGGCCTTGCAGAAGTCGTCCTTCCAGAGACAACTCACCGAGTTCTACGAACGCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4486R-1.in silico     121 CTGCAGCGGCCTTGCAGAAGTCGTCCTTCCAGAGACAACTCACCGAGTTCTACGAACGCA 180


4486R-1.IR_full       181 CTCGTCAACACAAACTGGTGGGCTTCTTCAATATGCGCACACCTATGATCACGCTAAACG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4486R-1.in silico     181 CTCGTCAACACAAACTGGTGGGCTTCTTCAATATGCGCACACCTATGATCACGCTAAACG 240


4486R-1.IR_full       241 ACCCGGAGCTGATCAAAAAGGTCTGCGTAAAGGACTTTGACCACTTCCCCAACCACCAGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4486R-1.in silico     241 ACCCGGAGCTGATCAAAAAGGTCTGCGTAAAGGACTTTGACCACTTCCCCAACCACCAGC 300


4486R-1.IR_full       301 CCTTCATCACCTCCAACGATCGCCTGTTCAACGACATGCTCAGCGTGATGAGGGACCAGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4486R-1.in silico     301 CCTTCATCACCTCCAACGATCGCCTGTTCAACGACATGCTCAGCGTGATGAGGGACCAGC 360


4486R-1.IR_full       361 GGTGGAAGCACATGAGAAACACCCTCACTCCGGTCTTCACGGCGGCCAAAATGCGCAACA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4486R-1.in silico     361 GGTGGAAGCACATGAGAAACACCCTCACTCCGGTCTTCACGGCGGCCAAAATGCGCAACA 420


4486R-1.IR_full       421 TGTTCACCCTGATGAACGAGAGCTTCGCGGAGTGCCTGCAGCACCTGGACAGCTCTTCGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4486R-1.in silico     421 TGTTCACCCTGATGAACGAGAGCTTCGCGGAGTGCCTGCAGCACCTGGACAGCTCTTCGA 480


4486R-1.IR_full       481 AAACGCTTCCCGGCAGAAAG 500
                          ||||||||||||||||||||
4486R-1.in silico     481 AAACGCTTCCCGGCAGAAAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078922.2  CG4486-RA (Cyp9b2), mRNA 
2.9   14  28  48  72  NM_078921.2  CG4485-RA (Cyp9b1), mRNA 
0   NM_165964.1  CG30487-RA (CG30487), mRNA 
0   NM_141880.2  CG10005-RA (CG10005), mRNA 
0   NM_079806.2  CG31062-RA (side), mRNA 
0   NM_132050.1  CG3011-RA (CG3011), mRNA 
0   NM_143702.2  CG5889-RA (Mdh), mRNA 
0   NM_137420.2  CG5009-RA (CG5009), mRNA 
0   NM_140184.2  CG7628-RA (CG7628), mRNA 
0   NM_141130.3  CG11489-RB, transcript variant B (CG11489), mRNA 
0   NM_176386.1  CG11489-RC, transcript variant C (CG11489), mRNA 
0   NM_057523.3  CG18412-RA (ph-p), mRNA 
0   NM_080055.2  CG3895-RA (ph-d), mRNA 
0   NM_166093.1  CG8174-RA, transcript variant A (SRPK), mRNA 
0   NM_137190.2  CG8174-RB, transcript variant B (SRPK), mRNA 
0   NM_166094.1  CG8174-RC, transcript variant C (SRPK), mRNA 
0   NM_140780.1  CG13700-RA (CG13700), mRNA 
0   NM_134869.2  CG2964-RA (CG2964), mRNA 
0   NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 
0   NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   NM_136727.2  CG18408-RA, transcript variant A (CAP), mRNA 
0   NM_079737.2  CG17077-RB, transcript variant B (pnt), mRNA 
0   NM_170070.1  CG17077-RC, transcript variant C (pnt), mRNA 
0   NM_170651.3  CG17077-RD, transcript variant D (pnt), mRNA 
0   NM_136647.2  CG8809-RA (Camta), mRNA 
0   NM_139684.2  CG17030-RA (CG17030), mRNA 
0   NM_138003.2  CG5591-RA (CG5591), mRNA 
0   NM_135201.1  CG9595-RA (osm-6), mRNA 
0   NM_168879.2  CG9936-RC, transcript variant C (skd), mRNA 
0   NM_079914.2  CG9936-RD, transcript variant D (skd), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.