National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4402R-2 
 Symbol lox2  Full Name lysyl oxidase-like 2 
 CG No CG4402  Old CG No CG4402 
 Synonyms Dmloxl-2, dmlox-2, CG4402, lox2 
 Accession No (Link to NCBI) NM_079082.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTGCGCAATCGAAGATCGA 
 Primer Seq. 3'
aatctagaggtaccAGTGCATTTTCCGGCGGGTAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGTGCGCAA TCGAAGATCG AAAGGTCCTC AAGATGGGGC TCACTCTTGT GTGCCTGACT 
0061 TTACTGGCCA TTCACATGGC AGATGCTGGT TGTGCAGCAC AGATCCTTGG AGGATGCTCG 
0121 ACAGGAGCGC CAGCGATTGG TGCACAGGTA CACAAAGGTC CTGAACAAGG AGGAGGGAGC 
0181 CATAAGACTG GTGGGCGGAG ATAATGAGTA CGAAGGCAAC ATTGAGGTCC TGCACAATGG 
0241 CAAGTGGGGA GCAGTTTGCG ATGACGAGTG GGATTCCACC GAAGCAGACA TTGTGTGCCG 
0301 ACAACTGGGT TTTCCCGGCA TGCGGAGGTA TACGAGAAGT GGCTTCTTTG GACCCGCTCG 
0361 TCGTCGCTTC TGGATGGACA ACCTCTTTTG CGAGGGTCAC GAGCAGGAAC TAGTGGATTG 
0421 CCATTTCGAG GGCTGGGGCG AGAACGATTG TGAACCAGGA GAGGCGGCTG GCGTGGTCTG 
0481 TTACCCGCCG GAAAATGCAC T 
 in silico PCR Fragment
0001 ATGTGCGCAA TCGAAGATCG AAAGGTCCTC AAGATGGGGC TCACTCTTGT GTGCCTGACT 
0061 TTACTGGCCA TTCACATGGC AGATGC-GGT TGTGCAGCAC AGATCCTTGG AGGATGCTCG 
0121 ACAGGAGCGC CAGCGATTGG TGCACAGGTA CACAAAGGTC CTGAACAAGG AGGAGGGAGC 
0181 CATAAGACTG GTGGGCGGAG ATAATGAGTA CGAAGGCAAC ATTGAGGTCC TGCACAATGG 
0241 CAAGTGGGGA GCAGTTTGCG ATGACGAGTG GGATTCCACC GAAGCAGACA TTGTGTGCCG 
0301 ACAACTGGGT TTTCCCGGCA TGCGGAGGTA TACGAGAAGT GGCTTCTTTG GACCCGCTCG 
0361 TCGTCGCTTC TGGATGGACA ACCTCTTTTG CGAGGGTCAC GAGCAGGAAC TAGTGGATTG 
0421 CCATTTCGAG GGCTGGGGCG AGAACGATTG TGAACCAGGA GAGGCGGCTG GCGTGGTCTG 
0481 TTACCCGCCG GAAAATGCAC T 
 Assemble Data

4402R-2.IR_full       1   ATGTGCGCAATCGAAGATCGAAAGGTCCTCAAGATGGGGCTCACTCTTGTGTGCCTGACT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4402R-2.in silico     1   ATGTGCGCAATCGAAGATCGAAAGGTCCTCAAGATGGGGCTCACTCTTGTGTGCCTGACT 60


4402R-2.IR_full       61  TTACTGGCCATTCACATGGCAGATGCTGGTTGTGCAGCACAGATCCTTGGAGGATGCTCG 120
                          |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
4402R-2.in silico     61  TTACTGGCCATTCACATGGCAGATGC-GGTTGTGCAGCACAGATCCTTGGAGGATGCTCG 120


4402R-2.IR_full       121 ACAGGAGCGCCAGCGATTGGTGCACAGGTACACAAAGGTCCTGAACAAGGAGGAGGGAGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4402R-2.in silico     121 ACAGGAGCGCCAGCGATTGGTGCACAGGTACACAAAGGTCCTGAACAAGGAGGAGGGAGC 180


4402R-2.IR_full       181 CATAAGACTGGTGGGCGGAGATAATGAGTACGAAGGCAACATTGAGGTCCTGCACAATGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4402R-2.in silico     181 CATAAGACTGGTGGGCGGAGATAATGAGTACGAAGGCAACATTGAGGTCCTGCACAATGG 240


4402R-2.IR_full       241 CAAGTGGGGAGCAGTTTGCGATGACGAGTGGGATTCCACCGAAGCAGACATTGTGTGCCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4402R-2.in silico     241 CAAGTGGGGAGCAGTTTGCGATGACGAGTGGGATTCCACCGAAGCAGACATTGTGTGCCG 300


4402R-2.IR_full       301 ACAACTGGGTTTTCCCGGCATGCGGAGGTATACGAGAAGTGGCTTCTTTGGACCCGCTCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4402R-2.in silico     301 ACAACTGGGTTTTCCCGGCATGCGGAGGTATACGAGAAGTGGCTTCTTTGGACCCGCTCG 360


4402R-2.IR_full       361 TCGTCGCTTCTGGATGGACAACCTCTTTTGCGAGGGTCACGAGCAGGAACTAGTGGATTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4402R-2.in silico     361 TCGTCGCTTCTGGATGGACAACCTCTTTTGCGAGGGTCACGAGCAGGAACTAGTGGATTG 420


4402R-2.IR_full       421 CCATTTCGAGGGCTGGGGCGAGAACGATTGTGAACCAGGAGAGGCGGCTGGCGTGGTCTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4402R-2.in silico     421 CCATTTCGAGGGCTGGGGCGAGAACGATTGTGAACCAGGAGAGGCGGCTGGCGTGGTCTG 480


4402R-2.IR_full       481 TTACCCGCCGGAAAATGCACT 501
                          |||||||||||||||||||||
4402R-2.in silico     481 TTACCCGCCGGAAAATGCACT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079082.3  CG4402-RA (lox2), mRNA 
0   NM_170166.2  CG13627-RB, transcript variant B (CG13627), mRNA 
0   NM_143022.2  CG13627-RA, transcript variant A (CG13627), mRNA 
0   NM_135438.2  CG13110-RA (CG13110), mRNA 
0   NM_132638.2  CG1591-RA (REG), mRNA 
0   NM_079760.2  CG6593-RA (Pp1alpha-96A), mRNA 
0   NM_142445.1  CG7146-RA (CG7146), mRNA 
0   NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_079208.2  CG4633-RA (Aats-ala-m), mRNA 
0   NM_164615.1  CG4145-RA, transcript variant A (Cg25C), mRNA 
0   NM_164616.1  CG4145-RB, transcript variant B (Cg25C), mRNA 
0   NM_164617.1  CG4145-RC, transcript variant C (Cg25C), mRNA 
0   NM_166435.1  CG10069-RC, transcript variant C (CG10069), mRNA 
0   NM_137726.2  CG10069-RA, transcript variant A (CG10069), mRNA 
0   NM_169148.3  CG2336-RA (CG2336), mRNA 
0   NM_166434.1  CG10069-RB, transcript variant B (CG10069), mRNA 
0   NM_165579.1  CG2910-RA, transcript variant A (nito), mRNA 
0   NM_136495.2  CG2910-RB, transcript variant B (nito), mRNA 
0   NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_168103.1  CG7507-RB, transcript variant B (Dhc64C), mRNA 
0   NM_141968.3  CG14391-RA (CG14391), mRNA 
0   NM_139783.1  CG10226-RA (CG10226), mRNA 
0   NM_134547.2  CG1670-RA (Obp19b), mRNA 
0   NM_078867.2  CG5526-RA (Dhc36C), mRNA 
0   NM_136821.2  CG13213-RA, transcript variant A (CG13213), mRNA 
0   NM_165815.1  CG13213-RB, transcript variant B (CG13213), mRNA 
0   NM_165816.1  CG13213-RC, transcript variant C (CG13213), mRNA 
0   NM_135916.1  CG7631-RA (CG7631), mRNA 
0   NM_139831.1  CG14826-RA (CG14826), mRNA 
0   NM_133143.1  CG8002-RA (rictor), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.