National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4365R-2 
 Symbol CG4365  Full Name CG4365 
 CG No CG4365  Old CG No CG4365 
 Synonyms CG4365 
 Accession No (Link to NCBI) NM_141001.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCTCCGTGGAGACCCAGTTG 
 Primer Seq. 3'
aatctagaggtaccCTGCTGCGCGGTGATGTGGTA 
 Predicted Fragment Size
480 
 IR fragment full Seq
0001 ACCTCCGTGG AGACCCAGTT GACGGCCACC TACTTCCGAG TGCAAAAACT ACGAAAAGTC 
0061 GGCTTCAGAG GCATGCACAG CACATTGGAG GACGTGCAGC TGGAGGGCAT GGAGATCAAA 
0121 GATCCTGCCG GCCCTGCAGG ATAACTATAT GTATCTGATT GTAGACACGA AAGGACGCGC 
0181 GAGGCGGCCG NTGGTGGATC CCGTGGAGCC GGAGCTGGTC ATTAAGACGG TGCAGGAGCA 
0241 GCAGCTGACC CTCAGCAAGG TGCTGACCAC GCACCATCAC TGGGACCACG CCGGTGGCAA 
0301 TGAAAAGCTG CTCAAGCTGT GGGAGAAGGA GCTGGACGTG TATGGCGGCG ATGACCGCAT 
0361 CGGGGCATTG AACAAAAAGG TTCAGCAGGA CGACACCTTC ACCATTGGTG GTCTGCATGT 
0421 CAAGTGCTTG TCCACGCCGT GCCACACTAC CGGCCACATC TGCTACCACA TCACCGCGCA 
0481 GCAG 
 in silico PCR Fragment
0001 ACCTCCGTGG AGACCCAGTT GACGGCCACC TACTTCCGAG TGCAAAAACT ACGAAAAGTC 
0061 GGCTTCAGAG GCATGCACAG CACATTGGAG GACGTGCAGC TGGAGGGCAT GGAGATC-AA 
0121 GATCCTGCCG GCCCTGCAGG ATAACTATAT GTATCTGATT GTAGACACGA A--GACGCGC 
0181 GAGGCGGCCG -TGGTGGATC CCGTGGAGCC GGAGCTGGTC ATTAAGACGG TGCAGGAGCA 
0241 GCAGCTGACC CTCAGCAAGG TGCTGACCAC GCACCATCAC TGGGACCACG CCGGTGGCAA 
0301 TGAAAAGCTG CTCAAGCTGT GGGAGAAGGA GCTGGACGTG TATGGCGGCG ATGACCGCAT 
0361 CGGGGCATTG AACAAAAAGG TTCAGCAGGA CGACACCTTC ACCATTGGTG GTCTGCATGT 
0421 CAAGTGCTTG TCCACGCCGT GCCACACTAC CGGCCACATC TGCTACCACA TCACCGCGCA 
0481 GCAG 
 Assemble Data

4365R-2.IR_full       1   ACCTCCGTGGAGACCCAGTTGACGGCCACCTACTTCCGAGTGCAAAAACTACGAAAAGTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4365R-2.in silico     1   ACCTCCGTGGAGACCCAGTTGACGGCCACCTACTTCCGAGTGCAAAAACTACGAAAAGTC 60


4365R-2.IR_full       61  GGCTTCAGAGGCATGCACAGCACATTGGAGGACGTGCAGCTGGAGGGCATGGAGATCAAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
4365R-2.in silico     61  GGCTTCAGAGGCATGCACAGCACATTGGAGGACGTGCAGCTGGAGGGCATGGAGATC-AA 120


4365R-2.IR_full       121 GATCCTGCCGGCCCTGCAGGATAACTATATGTATCTGATTGTAGACACGAAAGGACGCGC 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||
4365R-2.in silico     121 GATCCTGCCGGCCCTGCAGGATAACTATATGTATCTGATTGTAGACACGAA--GACGCGC 180


4365R-2.IR_full       181 GAGGCGGCCGNTGGTGGATCCCGTGGAGCCGGAGCTGGTCATTAAGACGGTGCAGGAGCA 240
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
4365R-2.in silico     181 GAGGCGGCCG-TGGTGGATCCCGTGGAGCCGGAGCTGGTCATTAAGACGGTGCAGGAGCA 240


4365R-2.IR_full       241 GCAGCTGACCCTCAGCAAGGTGCTGACCACGCACCATCACTGGGACCACGCCGGTGGCAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4365R-2.in silico     241 GCAGCTGACCCTCAGCAAGGTGCTGACCACGCACCATCACTGGGACCACGCCGGTGGCAA 300


4365R-2.IR_full       301 TGAAAAGCTGCTCAAGCTGTGGGAGAAGGAGCTGGACGTGTATGGCGGCGATGACCGCAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4365R-2.in silico     301 TGAAAAGCTGCTCAAGCTGTGGGAGAAGGAGCTGGACGTGTATGGCGGCGATGACCGCAT 360


4365R-2.IR_full       361 CGGGGCATTGAACAAAAAGGTTCAGCAGGACGACACCTTCACCATTGGTGGTCTGCATGT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4365R-2.in silico     361 CGGGGCATTGAACAAAAAGGTTCAGCAGGACGACACCTTCACCATTGGTGGTCTGCATGT 420


4365R-2.IR_full       421 CAAGTGCTTGTCCACGCCGTGCCACACTACCGGCCACATCTGCTACCACATCACCGCGCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4365R-2.in silico     421 CAAGTGCTTGTCCACGCCGTGCCACACTACCGGCCACATCTGCTACCACATCACCGCGCA 480


4365R-2.IR_full       481 GCAG 484
                          ||||
4365R-2.in silico     481 GCAG 484

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   462  NM_141001.2  CG4365-RA, transcript variant A (CG4365), mRNA 
96.1   444  NM_168873.1  CG4365-RC, transcript variant C (CG4365), mRNA 
91.34   422  NM_168874.1  CG4365-RB, transcript variant B (CG4365), mRNA 
0   NM_135838.2  CG7916-RA (CG7916), mRNA 
0   NM_134508.2  CG32528-RA (CG32528), mRNA 
0   NM_130487.2  CG18273-RA (CG18273), mRNA 
0   NM_168665.1  CG13035-RB, transcript variant B (CG13035), mRNA 
0   NM_140635.1  CG13035-RA, transcript variant A (CG13035), mRNA 
0   NM_140344.1  CG10967-RA (Atg1), mRNA 
0   NM_130602.2  CG3480-RA (mip130), mRNA 
0   10  NM_078587.2  CG4353-RC, transcript variant C (hep), mRNA 
0   10  NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 
0   NM_057391.3  CG1977-RA (alpha-Spec), mRNA 
0   NM_144032.1  CG14580-RA (CG14580), mRNA 
0   NM_139990.2  CG5971-RA (CG5971), mRNA 
0   NM_169422.1  CG6923-RB, transcript variant B (CG6923), mRNA 
0   NM_141855.2  CG6923-RA, transcript variant A (CG6923), mRNA 
0   NM_168037.1  CG32264-RA, transcript variant A (CG32264), mRNA 
0   NM_168796.1  CG32208-RA (825-Oak), mRNA 
0   NM_168797.1  CG32213-RA (CG32213), mRNA 
0   NM_206630.1  CG3312-RB, transcript variant B (Rnp4F), mRNA 
0   NM_078492.2  CG3312-RA, transcript variant A (Rnp4F), mRNA 
0   NM_132230.2  CG2272-RA (slpr), mRNA 
0   NM_001038985.1  CG14062-RB (CG14062), mRNA 
0   NM_165770.1  CG11763-RA, transcript variant A (micr), mRNA 
0   NM_001038849.1  CG11763-RD, transcript variant D (micr), mRNA 
0   NM_136741.2  CG11763-RC, transcript variant C (micr), mRNA 
0   NM_164454.1  CG31671-RA (tho2), mRNA 
0   NM_166514.1  CG6741-RA, transcript variant A (a), mRNA 
0   NM_001014543.1  CG6741-RC, transcript variant C (a), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.