National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4349R-3 
 Symbol Fer3HCH  Full Name Ferritin 3 heavy chain homologue 
 CG No CG4349  Old CG No CG4349 
 Synonyms CG4349, Fer3HCH 
 Accession No (Link to NCBI) NM_132626.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CACATGTGCATGCTGGTGCGTCAGAACTTCGCCAAAAGTTGCGAGAAGAAGCTAAACGAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAGATCAACATGGAGTTGAAGGCATCCCACCAGTATCTGGCCATGGCCTACCATTTCGAT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGCTCCGATATCAGTTCACCCGGAATGCATCGATTCTTCCTAAAGGCGAGCGTCGAGGAG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CGGGAGCACGCGGAGAAGATCATGACGTACATGAACAAGCGTGGTGGTCTAATCATTTTG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGCAGTGTACCACAGCCGTTGCCCTGTTTCGCCAGCACCTTGGATGCACTAAAGCACGCA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATGAAAATGGAACTGGAGGTCAATAAGCATCTGCTCGATTTGCACGCCCTGGCTGGCAAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAAGCGGATCCGAATCTCTGCGATTTCATCGAGGCCAATTTCCTGCAGGAGCAAGTGGAT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGCCAGAAGATTCTGGCCGACTATATTAGCCAATTGGAGAAGGCACAAAACCAGGTGGGC 480

4349R-3.IR_full       481 GAATTCCTGTTCGACAA 497
                          ||||||||||||||||| silico     481 GAATTCCTGTTCGACAA 497

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   479  NM_132626.1  CG4349-RA (Fer3HCH), mRNA 
0   NM_170479.1  CG2216-RB, transcript variant B (Fer1HCH), mRNA 
0   NM_170482.1  CG2216-RE, transcript variant E (Fer1HCH), mRNA 
0   NM_170481.1  CG2216-RD, transcript variant D (Fer1HCH), mRNA 
0   NM_170480.1  CG2216-RC, transcript variant C (Fer1HCH), mRNA 
0   NM_080134.2  CG2216-RA, transcript variant A (Fer1HCH), mRNA 
0   NM_176343.2  CG7730-RC (CG7730), mRNA 
0   NM_142096.1  CG3259-RA (CG3259), mRNA 
0   NM_001038967.1  CG8927-RB, transcript variant B (CG8927), mRNA 
0   NM_142270.1  CG8927-RA, transcript variant A (CG8927), mRNA 
0   NM_136398.3  CG9446-RA, transcript variant A (coro), mRNA 
0   NM_206031.1  CG9446-RC, transcript variant C (coro), mRNA 
0   NM_165494.1  CG9446-RB, transcript variant B (coro), mRNA 
0   NM_166147.1  CG8428-RE, transcript variant E (spin), mRNA 
0   NM_080084.2  CG8428-RD, transcript variant D (spin), mRNA 
0   NM_166146.1  CG8428-RB, transcript variant B (spin), mRNA 
0   NM_166145.1  CG8428-RA, transcript variant A (spin), mRNA 
0   NM_166144.1  CG8428-RC, transcript variant C (spin), mRNA 
0   NM_079919.2  CG5700-RB (prc), mRNA 
0   NM_166200.2  CG8912-RA, transcript variant A (Psi), mRNA 
0   NM_057775.3  CG8912-RB, transcript variant B (Psi), mRNA 
0   NM_206140.1  CG8912-RC, transcript variant C (Psi), mRNA 
0   NM_001014474.2  CG33531-RA (Ddr), mRNA 
0   NM_078616.3  CG10524-RA (Pkcdelta), mRNA 
0   NM_079319.2  CG4153-RA (eIF-2beta), mRNA 
0   NM_165338.1  CG1962-RB, transcript variant B (CG1962), mRNA 
0   NM_139957.2  CG17352-RC, transcript variant C (CG17352), mRNA 
0   NM_165339.2  CG1962-RC, transcript variant C (CG1962), mRNA 
0   NM_001038906.1  CG17352-RD, transcript variant D (CG17352), mRNA 
0   NM_136205.2  CG1962-RA, transcript variant A (CG1962), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.