National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4349R-1 
 Symbol Fer3HCH  Full Name Ferritin 3 heavy chain homologue 
 CG No CG4349  Old CG No CG4349 
 Synonyms CG4349, Fer3HCH 
 Accession No (Link to NCBI) NM_132626.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACATGTGCATGCTGGTGCGT 
 Primer Seq. 3'
aatctagaggtaccTTGTCGAACAGGAATTCGCCC 
 Predicted Fragment Size
497 
 IR fragment full Seq
0001 CACATGTGCA TGCTGGTGCG TCAGAACTTC GCCAAAAGTT GCGAGAAGAA GCTAAACGAT 
0061 CAGATCAACA TGGAGTTGAA GGCATCCCAC CAGTATCTGG CCATGGCCTA CCATTTCGAT 
0121 CGCTCCGATA TCAGTTCACC CGGAATGCAT CGATTCTTCC TAAAGGCGAG CGTCGAGGAG 
0181 CGGGAGCACG CGGAGAAGAT CATGACGTAC ATGAACAAGC GTGGTGGTCT AATCATTTTG 
0241 AGCAGTGTAC CACAGCCGTT GCCCTGTTTC GCCAGCACCT TGGATGCACT AAAGCACGCA 
0301 ATGAAAATGG AACTGGAGGT CAATAAGCAT CTGCTCGATT TGCACGCCCT GGCTGGCAAG 
0361 GAAGCGGATC CGAATCTCTG CGATTTCATC GAGGCCAATT TCCTGCAGGA GCAAGTGGAT 
0421 GGCCAGAAGA TTCTGGCCGA CTATATTAGC CAATTGGAGA AGGCACAAAA CCAGGTGGGC 
0481 GAATTCCTGT TCGACAA 
 in silico PCR Fragment
0001 CACATGTGCA TGCTGGTGCG TCAGAACTTC GCCAAAAGTT GCGAGAAGAA GCTAAACGAT 
0061 CAGATCAACA TGGAGTTGAA GGCATCCCAC CAGTATCTGG CCATGGCCTA CCATTTCGAT 
0121 CGCTCCGATA TCAGTTCACC CGGAATGCAT CGATTCTTCC TAAAGGCGAG CGTCGAGGAG 
0181 CGGGAGCACG CGGAGAAGAT CATGACGTAC ATGAACAAGC GTGGTGGTCT AATCATTTTG 
0241 AGCAGTGTAC CACAGCCGTT GCCCTGTTTC GCCAGCACCT TGGATGCACT AAAGCACGCA 
0301 ATGAAAATGG AACTGGAGGT CAATAAGCAT CTGCTCGATT TGCACGCCCT GGCTGGCAAG 
0361 GAAGCGGATC CGAATCTCTG CGATTTCATC GAGGCCAATT TCCTGCAGGA GCAAGTGGAT 
0421 GGCCAGAAGA TTCTGGCCGA CTATATTAGC CAATTGGAGA AGGCACAAAA CCAGGTGGGC 
0481 GAATTCCTGT TCGACAA 
 Assemble Data

4349R-1.IR_full       1   CACATGTGCATGCTGGTGCGTCAGAACTTCGCCAAAAGTTGCGAGAAGAAGCTAAACGAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4349R-1.in silico     1   CACATGTGCATGCTGGTGCGTCAGAACTTCGCCAAAAGTTGCGAGAAGAAGCTAAACGAT 60


4349R-1.IR_full       61  CAGATCAACATGGAGTTGAAGGCATCCCACCAGTATCTGGCCATGGCCTACCATTTCGAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4349R-1.in silico     61  CAGATCAACATGGAGTTGAAGGCATCCCACCAGTATCTGGCCATGGCCTACCATTTCGAT 120


4349R-1.IR_full       121 CGCTCCGATATCAGTTCACCCGGAATGCATCGATTCTTCCTAAAGGCGAGCGTCGAGGAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4349R-1.in silico     121 CGCTCCGATATCAGTTCACCCGGAATGCATCGATTCTTCCTAAAGGCGAGCGTCGAGGAG 180


4349R-1.IR_full       181 CGGGAGCACGCGGAGAAGATCATGACGTACATGAACAAGCGTGGTGGTCTAATCATTTTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4349R-1.in silico     181 CGGGAGCACGCGGAGAAGATCATGACGTACATGAACAAGCGTGGTGGTCTAATCATTTTG 240


4349R-1.IR_full       241 AGCAGTGTACCACAGCCGTTGCCCTGTTTCGCCAGCACCTTGGATGCACTAAAGCACGCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4349R-1.in silico     241 AGCAGTGTACCACAGCCGTTGCCCTGTTTCGCCAGCACCTTGGATGCACTAAAGCACGCA 300


4349R-1.IR_full       301 ATGAAAATGGAACTGGAGGTCAATAAGCATCTGCTCGATTTGCACGCCCTGGCTGGCAAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4349R-1.in silico     301 ATGAAAATGGAACTGGAGGTCAATAAGCATCTGCTCGATTTGCACGCCCTGGCTGGCAAG 360


4349R-1.IR_full       361 GAAGCGGATCCGAATCTCTGCGATTTCATCGAGGCCAATTTCCTGCAGGAGCAAGTGGAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4349R-1.in silico     361 GAAGCGGATCCGAATCTCTGCGATTTCATCGAGGCCAATTTCCTGCAGGAGCAAGTGGAT 420


4349R-1.IR_full       421 GGCCAGAAGATTCTGGCCGACTATATTAGCCAATTGGAGAAGGCACAAAACCAGGTGGGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4349R-1.in silico     421 GGCCAGAAGATTCTGGCCGACTATATTAGCCAATTGGAGAAGGCACAAAACCAGGTGGGC 480


4349R-1.IR_full       481 GAATTCCTGTTCGACAA 497
                          |||||||||||||||||
4349R-1.in silico     481 GAATTCCTGTTCGACAA 497

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   479  NM_132626.1  CG4349-RA (Fer3HCH), mRNA 
0   NM_170479.1  CG2216-RB, transcript variant B (Fer1HCH), mRNA 
0   NM_170482.1  CG2216-RE, transcript variant E (Fer1HCH), mRNA 
0   NM_170481.1  CG2216-RD, transcript variant D (Fer1HCH), mRNA 
0   NM_170480.1  CG2216-RC, transcript variant C (Fer1HCH), mRNA 
0   NM_080134.2  CG2216-RA, transcript variant A (Fer1HCH), mRNA 
0   NM_176343.2  CG7730-RC (CG7730), mRNA 
0   NM_142096.1  CG3259-RA (CG3259), mRNA 
0   NM_001038967.1  CG8927-RB, transcript variant B (CG8927), mRNA 
0   NM_142270.1  CG8927-RA, transcript variant A (CG8927), mRNA 
0   NM_136398.3  CG9446-RA, transcript variant A (coro), mRNA 
0   NM_206031.1  CG9446-RC, transcript variant C (coro), mRNA 
0   NM_165494.1  CG9446-RB, transcript variant B (coro), mRNA 
0   NM_166147.1  CG8428-RE, transcript variant E (spin), mRNA 
0   NM_080084.2  CG8428-RD, transcript variant D (spin), mRNA 
0   NM_166146.1  CG8428-RB, transcript variant B (spin), mRNA 
0   NM_166145.1  CG8428-RA, transcript variant A (spin), mRNA 
0   NM_166144.1  CG8428-RC, transcript variant C (spin), mRNA 
0   NM_079919.2  CG5700-RB (prc), mRNA 
0   NM_166200.2  CG8912-RA, transcript variant A (Psi), mRNA 
0   NM_057775.3  CG8912-RB, transcript variant B (Psi), mRNA 
0   NM_206140.1  CG8912-RC, transcript variant C (Psi), mRNA 
0   NM_001014474.2  CG33531-RA (Ddr), mRNA 
0   NM_078616.3  CG10524-RA (Pkcdelta), mRNA 
0   NM_079319.2  CG4153-RA (eIF-2beta), mRNA 
0   NM_165338.1  CG1962-RB, transcript variant B (CG1962), mRNA 
0   NM_139957.2  CG17352-RC, transcript variant C (CG17352), mRNA 
0   NM_165339.2  CG1962-RC, transcript variant C (CG1962), mRNA 
0   NM_001038906.1  CG17352-RD, transcript variant D (CG17352), mRNA 
0   NM_136205.2  CG1962-RA, transcript variant A (CG1962), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.