National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4332R-4 
 Symbol CG4332  Full Name CG4332 
 CG No CG4332  Old CG No CG4332 
 Synonyms CG4332 
 Accession No (Link to NCBI) NM_132633.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCCCTCGATCTCCACGCTTC 
 Primer Seq. 3'
aatctagaggtaccACGTCCAGTGGTGGAGGCTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCCCTCGAT CTCCACGCTT CTAGGCGTTG CATTTCTGGC GTACATCGGC CACTCCATCT 
0061 ACCAGATGTC GCAGCTCTTC ANCTACGCTG CAATGCAGCG GTNGTGCCGT GCTACACATC 
0121 ATTCCTGGCG GGACAGGCCA CGCCTGCAAC TGGCATTGTT TTCCTCCCTC AGCAGAAGTC 
0181 CCATTGCCAC CGAGGTGCGG GATCTGTACA AGGCCAAGAG GTTCGACTAT GATCAAAACT 
0241 TTGAGCACGA CTTCGAAGTG GATGTGCCGC TGAGGACGCG CCGGAATGGC TCCCTGTATC 
0301 TTCATGTGGT CTTGGCCTTG GAGGGTGAGC CACTGGAATG GCGTANNCTG CGCAGAGATG 
0361 GGCCCACCGT TGTCCATACG ATGAGTCTCA CGGATTACAT AGTGCCGCGG GCGGAGGCCT 
0421 TTAAACTGCT TGGAGATTCC GAGAAAGGTG CAGCAGCCGC TGTCCAGGAG AAAGAAAAGA 
0481 AGAAAGCCTC CACCACTGGA CGT 
 in silico PCR Fragment
0001 TGCCCTCGAT CTCCACGCTT CTAGGCGTTG CATTTCTGGC GTACATCGGC CACTCCATCT 
0061 ACCAGATGTC GCAGCTCTTC A-CTACGCTG CAATGCAGCG GT-GTGCCGT GCTACACATC 
0121 ATTCCTGGC- GGACAGGCCA CGCCTGCAAC TGGCATTGTT TTCCTCCCTC AGCAGAAGTC 
0181 CCATTGCCAC CGAGGTGCGG GATCTGTACA AGGCCAAGAG GTTCGACTAT GATCAAAACT 
0241 TTGAGCACGA CTTCGAAGTG GATGTGCCGC TGAGGACGCG CCGGAATGGC TCCCTGTATC 
0301 TTCATGTGGT CTTGGCCTTG GAGGGTGAGC CACTGGAATG GCGTAGCCTG CGCAGAGATG 
0361 GGCCCACCGT TGTCCATACG ATGAGTCTCA CGGATTACAT AGTGCCGCGG GCGGAGGCCT 
0421 TTAAACTGCT TGGAGATTCC GAGAAAGGTG CAGCAGCCGC TGTCCAGGAG AAAGAAAAGA 
0481 AGAAAGCCTC CACCACTGGA CGT 
 Assemble Data

4332R-4.IR_full       1   TGCCCTCGATCTCCACGCTTCTAGGCGTTGCATTTCTGGCGTACATCGGCCACTCCATCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4332R-4.in silico     1   TGCCCTCGATCTCCACGCTTCTAGGCGTTGCATTTCTGGCGTACATCGGCCACTCCATCT 60


4332R-4.IR_full       61  ACCAGATGTCGCAGCTCTTCANCTACGCTGCAATGCAGCGGTNGTGCCGTGCTACACATC 120
                          ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||
4332R-4.in silico     61  ACCAGATGTCGCAGCTCTTCA-CTACGCTGCAATGCAGCGGT-GTGCCGTGCTACACATC 120


4332R-4.IR_full       121 ATTCCTGGCGGGACAGGCCACGCCTGCAACTGGCATTGTTTTCCTCCCTCAGCAGAAGTC 180
                          ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
4332R-4.in silico     121 ATTCCTGGC-GGACAGGCCACGCCTGCAACTGGCATTGTTTTCCTCCCTCAGCAGAAGTC 180


4332R-4.IR_full       181 CCATTGCCACCGAGGTGCGGGATCTGTACAAGGCCAAGAGGTTCGACTATGATCAAAACT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4332R-4.in silico     181 CCATTGCCACCGAGGTGCGGGATCTGTACAAGGCCAAGAGGTTCGACTATGATCAAAACT 240


4332R-4.IR_full       241 TTGAGCACGACTTCGAAGTGGATGTGCCGCTGAGGACGCGCCGGAATGGCTCCCTGTATC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4332R-4.in silico     241 TTGAGCACGACTTCGAAGTGGATGTGCCGCTGAGGACGCGCCGGAATGGCTCCCTGTATC 300


4332R-4.IR_full       301 TTCATGTGGTCTTGGCCTTGGAGGGTGAGCCACTGGAATGGCGTANNCTGCGCAGAGATG 360
                          |||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||
4332R-4.in silico     301 TTCATGTGGTCTTGGCCTTGGAGGGTGAGCCACTGGAATGGCGTAGCCTGCGCAGAGATG 360


4332R-4.IR_full       361 GGCCCACCGTTGTCCATACGATGAGTCTCACGGATTACATAGTGCCGCGGGCGGAGGCCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4332R-4.in silico     361 GGCCCACCGTTGTCCATACGATGAGTCTCACGGATTACATAGTGCCGCGGGCGGAGGCCT 420


4332R-4.IR_full       421 TTAAACTGCTTGGAGATTCCGAGAAAGGTGCAGCAGCCGCTGTCCAGGAGAAAGAAAAGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4332R-4.in silico     421 TTAAACTGCTTGGAGATTCCGAGAAAGGTGCAGCAGCCGCTGTCCAGGAGAAAGAAAAGA 480


4332R-4.IR_full       481 AGAAAGCCTCCACCACTGGACGT 503
                          |||||||||||||||||||||||
4332R-4.in silico     481 AGAAAGCCTCCACCACTGGACGT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132633.2  CG4332-RA (CG4332), mRNA 
0.2   NM_167050.1  CG3086-RC, transcript variant C (MAPk-Ak2), mRNA 
0.2   NM_080030.3  CG3086-RB, transcript variant B (MAPk-Ak2), mRNA 
0.2   NM_176688.1  CG3086-RD, transcript variant D (MAPk-Ak2), mRNA 
0   NM_078582.3  CG32659-RA (Ten-a), mRNA 
0   NM_140397.1  CG10089-RD, transcript variant D (CG10089), mRNA 
0   NM_135708.1  CG17211-RA (CG17211), mRNA 
0   NM_078570.2  CG1763-RA (nod), mRNA 
0   NM_057403.3  CG5753-RA, transcript variant A (stau), mRNA 
0   NM_166263.1  CG5753-RB, transcript variant B (stau), mRNA 
0   NM_079860.2  CG12073-RA (5-HT7), mRNA 
0   NM_141494.1  CG10445-RA (CG10445), mRNA 
0   NM_057679.4  CG5371-RA (RnrL), mRNA 
0   NM_165019.2  CG5792-RB, transcript variant B (CG5792), mRNA 
0   NM_135746.2  CG5792-RA, transcript variant A (CG5792), mRNA 
0   NM_057866.2  CG10800-RA (Rca1), mRNA 
0   NM_142445.1  CG7146-RA (CG7146), mRNA 
0   NM_135321.1  CG14532-RA (CG14532), mRNA 
0   NM_079805.2  CG5954-RA, transcript variant A (l(3)mbt), mRNA 
0   NM_170330.1  CG5954-RB, transcript variant B (l(3)mbt), mRNA 
0   NM_143320.2  CG18437-RA (CG18437), mRNA 
0   NM_137138.1  CG12865-RA (CG12865), mRNA 
0   NM_139453.1  CG13804-RA (yellow-g2), mRNA 
0   NM_141417.2  CG1315-RA (CG1315), mRNA 
0   NM_130635.2  CG3078-RA (CG3078), mRNA 
0   12  NM_165285.1  CG31797-RA (CG31797), mRNA 
0   NM_143298.1  CG3368-RA (CG3368), mRNA 
0   NM_138070.2  CG3492-RA (CG3492), mRNA 
0   NM_135365.2  CG7787-RA (CG7787), mRNA 
0   NM_141178.3  CG12581-RA, transcript variant A (CG12581), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.