National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4332R-3 
 Symbol CG4332  Full Name CG4332 
 CG No CG4332  Old CG No CG4332 
 Synonyms CG4332 
 Accession No (Link to NCBI) NM_132633.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGCCCTCGATCTCCACGCTTCTAGGCGTTGCATTTCTGGCGTACATCGGCCACTCCATCT 60

                          ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| silico     61  ACCAGATGTCGCAGCTCTTCA-CTACGCTGCAATGCAGCGGT-GTGCCGTGCTACACATC 120

                          ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATTCCTGGC-GGACAGGCCACGCCTGCAACTGGCATTGTTTTCCTCCCTCAGCAGAAGTC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCATTGCCACCGAGGTGCGGGATCTGTACAAGGCCAAGAGGTTCGACTATGATCAAAACT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTGAGCACGACTTCGAAGTGGATGTGCCGCTGAGGACGCGCCGGAATGGCTCCCTGTATC 300

                          |||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||| silico     301 TTCATGTGGTCTTGGCCTTGGAGGGTGAGCCACTGGAATGGCGTAGCCTGCGCAGAGATG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGCCCACCGTTGTCCATACGATGAGTCTCACGGATTACATAGTGCCGCGGGCGGAGGCCT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTAAACTGCTTGGAGATTCCGAGAAAGGTGCAGCAGCCGCTGTCCAGGAGAAAGAAAAGA 480

4332R-3.IR_full       481 AGAAAGCCTCCACCACTGGACGT 503
                          ||||||||||||||||||||||| silico     481 AGAAAGCCTCCACCACTGGACGT 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132633.2  CG4332-RA (CG4332), mRNA 
0.2   NM_167050.1  CG3086-RC, transcript variant C (MAPk-Ak2), mRNA 
0.2   NM_080030.3  CG3086-RB, transcript variant B (MAPk-Ak2), mRNA 
0.2   NM_176688.1  CG3086-RD, transcript variant D (MAPk-Ak2), mRNA 
0   NM_078582.3  CG32659-RA (Ten-a), mRNA 
0   NM_140397.1  CG10089-RD, transcript variant D (CG10089), mRNA 
0   NM_135708.1  CG17211-RA (CG17211), mRNA 
0   NM_078570.2  CG1763-RA (nod), mRNA 
0   NM_057403.3  CG5753-RA, transcript variant A (stau), mRNA 
0   NM_166263.1  CG5753-RB, transcript variant B (stau), mRNA 
0   NM_079860.2  CG12073-RA (5-HT7), mRNA 
0   NM_141494.1  CG10445-RA (CG10445), mRNA 
0   NM_057679.4  CG5371-RA (RnrL), mRNA 
0   NM_165019.2  CG5792-RB, transcript variant B (CG5792), mRNA 
0   NM_135746.2  CG5792-RA, transcript variant A (CG5792), mRNA 
0   NM_057866.2  CG10800-RA (Rca1), mRNA 
0   NM_142445.1  CG7146-RA (CG7146), mRNA 
0   NM_135321.1  CG14532-RA (CG14532), mRNA 
0   NM_079805.2  CG5954-RA, transcript variant A (l(3)mbt), mRNA 
0   NM_170330.1  CG5954-RB, transcript variant B (l(3)mbt), mRNA 
0   NM_143320.2  CG18437-RA (CG18437), mRNA 
0   NM_137138.1  CG12865-RA (CG12865), mRNA 
0   NM_139453.1  CG13804-RA (yellow-g2), mRNA 
0   NM_141417.2  CG1315-RA (CG1315), mRNA 
0   NM_130635.2  CG3078-RA (CG3078), mRNA 
0   12  NM_165285.1  CG31797-RA (CG31797), mRNA 
0   NM_143298.1  CG3368-RA (CG3368), mRNA 
0   NM_138070.2  CG3492-RA (CG3492), mRNA 
0   NM_135365.2  CG7787-RA (CG7787), mRNA 
0   NM_141178.3  CG12581-RA, transcript variant A (CG12581), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.