National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4330R-3 
 Symbol CG4330  Full Name CG4330 
 CG No CG4330  Old CG No CG4330 
 Synonyms AA202479, CG4330 
 Accession No (Link to NCBI) NM_132629.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male terminal colorless 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GTGGCCATGGTGAACCAAACGGCAATTCCGCACAGCAACTCATCGGTGATTGATACGGAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACGTGTCCACTACCGGCACCACATCACAATGGTAGCGATCCCAATCCGCAGAAGGAGGGC 120

                          ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| silico     121 GAGTTTGTGTGGGACGAGGCCACGCAGGG-ATTGGTGCTCGGCAGTTTCTTCTATGGCTA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGTGCTAACCCAAGTGCCCGGCGGACGGATGGCCGAGCTGTATGGTGGGAAGAAGATCTA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGGCTATGGAGTGTTGATCACGGCGGTCTTTACGCTTATAACTCCATTGGCTGCCCACTG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGATCTGCCGCTGTTGGTCCTGGTCCGCATCCTGGAGGGAATGGGCGAGGGCGTCACCTA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCCAGCTATGCACGCCATGCTTGCCCACTGGATACCGCCGCTGGAGAGGAACAAGTTCGC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGCAATCGTCTATGCGGGCTCCAATATCGGAACAGTCATTTCCATGCCGCTGGCCGGATG 480

4330R-3.IR_full       481 GCTGTGCTCGCTGGACTTCCT 501
                          ||||||||||||||||||||| silico     481 GCTGTGCTCGCTGGACTTCCT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132629.1  CG4330-RA (CG4330), mRNA 
0   12  14  NM_131960.1  CG6978-RA (CG6978), mRNA 
0   11  NM_166187.1  CG8098-RB, transcript variant B (Picot), mRNA 
0   10  NM_137302.2  CG8098-RA, transcript variant A (Picot), mRNA 
0   NM_134837.2  CG9887-RA (VGlut), mRNA 
0   NM_134728.1  CG4726-RA (CG4726), mRNA 
0   NM_079607.2  CG6174-RA (Arp87C), mRNA 
0   NM_169839.1  CG17836-RA, transcript variant A (CG17836), mRNA 
0   NM_142504.2  CG17836-RB, transcript variant B (CG17836), mRNA 
0   NM_136503.2  CG12769-RA, transcript variant A (CG12769), mRNA 
0   NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
0   NM_140010.1  CG13313-RA (CG13313), mRNA 
0   NM_132951.2  CG4928-RB, transcript variant B (CG4928), mRNA 
0   NM_167552.1  CG4928-RA, transcript variant A (CG4928), mRNA 
0   NM_137194.1  CG8179-RA (CG8179), mRNA 
0   NM_140976.2  CG5130-RA, transcript variant A (CG5130), mRNA 
0   NM_168859.1  CG5130-RB, transcript variant B (CG5130), mRNA 
0   NM_169697.2  CG3978-RB, transcript variant B (pnr), mRNA 
0   NM_057337.2  CG3978-RA, transcript variant A (pnr), mRNA 
0   NM_132948.3  CG9099-RA (CG9099), mRNA 
0   NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0   NM_136059.2  CG10369-RA (Irk3), mRNA 
0   NM_139531.3  CG32269-RA, transcript variant A (CG32269), mRNA 
0   NM_134914.2  CG3332-RA, transcript variant A (CG3332), mRNA 
0   NM_164531.1  CG3332-RB, transcript variant B (CG3332), mRNA 
0   NM_168003.2  CG32270-RA, transcript variant A (CG32270), mRNA 
0   NM_142237.2  CG4606-RA (alpha-Man-IIb), mRNA 
0   NM_080317.2  CG2647-RA (per), mRNA 
0   NM_140097.1  CG6749-RA (CG6749), mRNA 
0   NM_176174.1  CG12864-RB, transcript variant B (Su(var)2-HP2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.