National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4330R-1 
 Symbol CG4330  Full Name CG4330 
 CG No CG4330  Old CG No CG4330 
 Synonyms AA202479, CG4330 
 Accession No (Link to NCBI) NM_132629.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGGCCATGGTGAACCAAACG 
 Primer Seq. 3'
aatctagaggtaccAGGAAGTCCAGCGAGCACAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTGGCCATGG TGAACCAAAC GGCAATTCCG CACAGCAACT CATCGGTGAT TGATACGGAC 
0061 ACGTGTCCAC TACCGGCACC ACATCACAAT GGTAGCGATC CCAATCCGCA GAAGGAGGGC 
0121 GAGTTTGTGT GGGACGAGGC CACGCAGGGN ATTGGTGCTC GGCAGTTTCT TCTATGGCTA 
0181 TGTGCTAACC CAAGTGCCCG GCGGACGGAT GGCCGAGCTG TATGGTGGGA AGAAGATCTA 
0241 CGGCTATGGA GTGTTGATCA CGGCGGTCTT TACGCTTATA ACTCCATTGG CTGCCCACTG 
0301 GGATCTGCCG CTGTTGGTCC TGGTCCGCAT CCTGGAGGGA ATGGGCGAGG GCGTCACCTA 
0361 TCCAGCTATG CACGCCATGC TTGCCCACTG GATACCGCCG CTGGAGAGGA ACAAGTTCGC 
0421 CGCAATCGTC TATGCGGGCT CCAATATCGG AACAGTCATT TCCATGCCGC TGGCCGGATG 
0481 GCTGTGCTCG CTGGACTTCC T 
 in silico PCR Fragment
0001 GTGGCCATGG TGAACCAAAC GGCAATTCCG CACAGCAACT CATCGGTGAT TGATACGGAC 
0061 ACGTGTCCAC TACCGGCACC ACATCACAAT GGTAGCGATC CCAATCCGCA GAAGGAGGGC 
0121 GAGTTTGTGT GGGACGAGGC CACGCAGGG- ATTGGTGCTC GGCAGTTTCT TCTATGGCTA 
0181 TGTGCTAACC CAAGTGCCCG GCGGACGGAT GGCCGAGCTG TATGGTGGGA AGAAGATCTA 
0241 CGGCTATGGA GTGTTGATCA CGGCGGTCTT TACGCTTATA ACTCCATTGG CTGCCCACTG 
0301 GGATCTGCCG CTGTTGGTCC TGGTCCGCAT CCTGGAGGGA ATGGGCGAGG GCGTCACCTA 
0361 TCCAGCTATG CACGCCATGC TTGCCCACTG GATACCGCCG CTGGAGAGGA ACAAGTTCGC 
0421 CGCAATCGTC TATGCGGGCT CCAATATCGG AACAGTCATT TCCATGCCGC TGGCCGGATG 
0481 GCTGTGCTCG CTGGACTTCC T 
 Assemble Data

4330R-1.IR_full       1   GTGGCCATGGTGAACCAAACGGCAATTCCGCACAGCAACTCATCGGTGATTGATACGGAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4330R-1.in silico     1   GTGGCCATGGTGAACCAAACGGCAATTCCGCACAGCAACTCATCGGTGATTGATACGGAC 60


4330R-1.IR_full       61  ACGTGTCCACTACCGGCACCACATCACAATGGTAGCGATCCCAATCCGCAGAAGGAGGGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4330R-1.in silico     61  ACGTGTCCACTACCGGCACCACATCACAATGGTAGCGATCCCAATCCGCAGAAGGAGGGC 120


4330R-1.IR_full       121 GAGTTTGTGTGGGACGAGGCCACGCAGGGNATTGGTGCTCGGCAGTTTCTTCTATGGCTA 180
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
4330R-1.in silico     121 GAGTTTGTGTGGGACGAGGCCACGCAGGG-ATTGGTGCTCGGCAGTTTCTTCTATGGCTA 180


4330R-1.IR_full       181 TGTGCTAACCCAAGTGCCCGGCGGACGGATGGCCGAGCTGTATGGTGGGAAGAAGATCTA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4330R-1.in silico     181 TGTGCTAACCCAAGTGCCCGGCGGACGGATGGCCGAGCTGTATGGTGGGAAGAAGATCTA 240


4330R-1.IR_full       241 CGGCTATGGAGTGTTGATCACGGCGGTCTTTACGCTTATAACTCCATTGGCTGCCCACTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4330R-1.in silico     241 CGGCTATGGAGTGTTGATCACGGCGGTCTTTACGCTTATAACTCCATTGGCTGCCCACTG 300


4330R-1.IR_full       301 GGATCTGCCGCTGTTGGTCCTGGTCCGCATCCTGGAGGGAATGGGCGAGGGCGTCACCTA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4330R-1.in silico     301 GGATCTGCCGCTGTTGGTCCTGGTCCGCATCCTGGAGGGAATGGGCGAGGGCGTCACCTA 360


4330R-1.IR_full       361 TCCAGCTATGCACGCCATGCTTGCCCACTGGATACCGCCGCTGGAGAGGAACAAGTTCGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4330R-1.in silico     361 TCCAGCTATGCACGCCATGCTTGCCCACTGGATACCGCCGCTGGAGAGGAACAAGTTCGC 420


4330R-1.IR_full       421 CGCAATCGTCTATGCGGGCTCCAATATCGGAACAGTCATTTCCATGCCGCTGGCCGGATG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4330R-1.in silico     421 CGCAATCGTCTATGCGGGCTCCAATATCGGAACAGTCATTTCCATGCCGCTGGCCGGATG 480


4330R-1.IR_full       481 GCTGTGCTCGCTGGACTTCCT 501
                          |||||||||||||||||||||
4330R-1.in silico     481 GCTGTGCTCGCTGGACTTCCT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132629.1  CG4330-RA (CG4330), mRNA 
0   12  14  NM_131960.1  CG6978-RA (CG6978), mRNA 
0   11  NM_166187.1  CG8098-RB, transcript variant B (Picot), mRNA 
0   10  NM_137302.2  CG8098-RA, transcript variant A (Picot), mRNA 
0   NM_134837.2  CG9887-RA (VGlut), mRNA 
0   NM_134728.1  CG4726-RA (CG4726), mRNA 
0   NM_079607.2  CG6174-RA (Arp87C), mRNA 
0   NM_169839.1  CG17836-RA, transcript variant A (CG17836), mRNA 
0   NM_142504.2  CG17836-RB, transcript variant B (CG17836), mRNA 
0   NM_136503.2  CG12769-RA, transcript variant A (CG12769), mRNA 
0   NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
0   NM_140010.1  CG13313-RA (CG13313), mRNA 
0   NM_132951.2  CG4928-RB, transcript variant B (CG4928), mRNA 
0   NM_167552.1  CG4928-RA, transcript variant A (CG4928), mRNA 
0   NM_137194.1  CG8179-RA (CG8179), mRNA 
0   NM_140976.2  CG5130-RA, transcript variant A (CG5130), mRNA 
0   NM_168859.1  CG5130-RB, transcript variant B (CG5130), mRNA 
0   NM_169697.2  CG3978-RB, transcript variant B (pnr), mRNA 
0   NM_057337.2  CG3978-RA, transcript variant A (pnr), mRNA 
0   NM_132948.3  CG9099-RA (CG9099), mRNA 
0   NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0   NM_136059.2  CG10369-RA (Irk3), mRNA 
0   NM_139531.3  CG32269-RA, transcript variant A (CG32269), mRNA 
0   NM_134914.2  CG3332-RA, transcript variant A (CG3332), mRNA 
0   NM_164531.1  CG3332-RB, transcript variant B (CG3332), mRNA 
0   NM_168003.2  CG32270-RA, transcript variant A (CG32270), mRNA 
0   NM_142237.2  CG4606-RA (alpha-Man-IIb), mRNA 
0   NM_080317.2  CG2647-RA (per), mRNA 
0   NM_140097.1  CG6749-RA (CG6749), mRNA 
0   NM_176174.1  CG12864-RB, transcript variant B (Su(var)2-HP2), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++  
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.