National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4289R-1 
 Symbol CG4289  Full Name CG4289 
 CG No CG4289  Old CG No CG4289 
 Synonyms CG4289 
 Accession No (Link to NCBI) NM_140996.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAAACACCAAGGTGCGCCACA 
 Primer Seq. 3'
aatctagaggtaccAAGCAGGCCCTTAATGGCATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAAACACCAA GGTGCGCCAC ACGACACTTA TCCAGAAGCA GCAGTTCCTA CGGTCCAAAG 
0061 GTCTCACCGC TCACGAAATT CAGCTGGCCT GTGAACGGGC CGGCGTTTTT CACCCAAGAC 
0121 CCCAACAAGC CCAATCCGAA TCCGAACACC GTCATTAGCA TTGGATCCCA ATTGCACGCG 
0181 CTGCAGCCGC AGCCGACTGT CTTGGGCCGG ATCAGGGAAA TCATCCATTC GGCAGCCCTG 
0241 TTCAGCGGAG TCGTCTACGC AGTCTACATC TTCTGGAAGC AATACATTGC GCCCTACCTG 
0301 TTCGGCAAGT CCAAGAAGAA GGCGGTCGAT GAAGTCCTGG ACGACATAGA CAAGAAGGTA 
0361 GAGACCCGCA CCAACGACCT CAACAAGGAG ATTTTGGCGG TCAGGGATCT GATCACCACA 
0421 CAGCAAAGGG AACACGCCCA GCAGCTGAAC CGCGAATTTA GTAACTTCCG TAGCGATCTG 
0481 GATGCCATTA AGGGCCTGCT T 
 in silico PCR Fragment
0001 AAAACACCAA GGTGCGCCAC ACGACACTTA TCCAGAAGCA GCAGTTCCTA CGGTCCAAAG 
0061 GTCTCACCGC TCACGAAATT CAGCTGGCCT GTGAACGGGC CGGCG-TTTT CACCCAAGAC 
0121 CCCAACAAGC CCAATCCGAA TCCGAACACC GTCATTAGCA TTGGATCCCA ATTGCACGCG 
0181 CTGCAGCCGC AGCCGACTGT CTTGGGCCGG ATCAGGGAAA TCATCCATTC GGCAGCCCTG 
0241 TTCAGCGGAG TCGTCTACGC AGTCTACATC TTCTGGAAGC AATACATTGC GCCCTACCTG 
0301 TTCGGCAAGT CCAAGAAGAA GGCGGTCGAT GAAGTCCTGG ACGACATAGA CAAGAAGGTA 
0361 GAGACCCGCA CCAACGACCT CAACAAGGAG ATTTTGGCGG TCAGGGATCT GATCACCACA 
0421 CAGCAAAGGG AACACGCCCA GCAGCTGAAC CGCGAATTTA GTAACTTCCG TAGCGATCTG 
0481 GATGCCATTA AGGGCCTGCT T 
 Assemble Data

4289R-1.IR_full       1   AAAACACCAAGGTGCGCCACACGACACTTATCCAGAAGCAGCAGTTCCTACGGTCCAAAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4289R-1.in silico     1   AAAACACCAAGGTGCGCCACACGACACTTATCCAGAAGCAGCAGTTCCTACGGTCCAAAG 60


4289R-1.IR_full       61  GTCTCACCGCTCACGAAATTCAGCTGGCCTGTGAACGGGCCGGCGTTTTTCACCCAAGAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
4289R-1.in silico     61  GTCTCACCGCTCACGAAATTCAGCTGGCCTGTGAACGGGCCGGCG-TTTTCACCCAAGAC 120


4289R-1.IR_full       121 CCCAACAAGCCCAATCCGAATCCGAACACCGTCATTAGCATTGGATCCCAATTGCACGCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4289R-1.in silico     121 CCCAACAAGCCCAATCCGAATCCGAACACCGTCATTAGCATTGGATCCCAATTGCACGCG 180


4289R-1.IR_full       181 CTGCAGCCGCAGCCGACTGTCTTGGGCCGGATCAGGGAAATCATCCATTCGGCAGCCCTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4289R-1.in silico     181 CTGCAGCCGCAGCCGACTGTCTTGGGCCGGATCAGGGAAATCATCCATTCGGCAGCCCTG 240


4289R-1.IR_full       241 TTCAGCGGAGTCGTCTACGCAGTCTACATCTTCTGGAAGCAATACATTGCGCCCTACCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4289R-1.in silico     241 TTCAGCGGAGTCGTCTACGCAGTCTACATCTTCTGGAAGCAATACATTGCGCCCTACCTG 300


4289R-1.IR_full       301 TTCGGCAAGTCCAAGAAGAAGGCGGTCGATGAAGTCCTGGACGACATAGACAAGAAGGTA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4289R-1.in silico     301 TTCGGCAAGTCCAAGAAGAAGGCGGTCGATGAAGTCCTGGACGACATAGACAAGAAGGTA 360


4289R-1.IR_full       361 GAGACCCGCACCAACGACCTCAACAAGGAGATTTTGGCGGTCAGGGATCTGATCACCACA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4289R-1.in silico     361 GAGACCCGCACCAACGACCTCAACAAGGAGATTTTGGCGGTCAGGGATCTGATCACCACA 420


4289R-1.IR_full       421 CAGCAAAGGGAACACGCCCAGCAGCTGAACCGCGAATTTAGTAACTTCCGTAGCGATCTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4289R-1.in silico     421 CAGCAAAGGGAACACGCCCAGCAGCTGAACCGCGAATTTAGTAACTTCCGTAGCGATCTG 480


4289R-1.IR_full       481 GATGCCATTAAGGGCCTGCTT 501
                          |||||||||||||||||||||
4289R-1.in silico     481 GATGCCATTAAGGGCCTGCTT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140996.2  CG4289-RA (CG4289), mRNA 
0.2   NM_132423.1  CG11556-RA (Rph), mRNA 
0   NM_140872.1  CG9330-RA (CG9330), mRNA 
0   NM_167996.1  CG32278-RA (CG32278), mRNA 
0   NM_057944.3  CG12249-RB, transcript variant B (mira), mRNA 
0   NM_057943.3  CG12249-RA, transcript variant A (mira), mRNA 
0   NM_135193.2  CG9543-RA (epsilonCOP), mRNA 
0   NM_132886.1  CG9914-RA (CG9914), mRNA 
0   NM_137715.1  CG4279-RA (CG4279), mRNA 
0   NM_001014526.1  CG33528-RE, transcript variant E (CG33528), mRNA 
0   NM_137036.2  CG13330-RA (CG13330), mRNA 
0   NM_140966.1  CG5262-RA (CG5262), mRNA 
0   NM_140909.1  CG17736-RA (schuy), mRNA 
0   NM_136390.2  CG3420-RA (CG3420), mRNA 
0   10  NM_137571.1  CG9416-RA (CG9416), mRNA 
0   NM_143459.1  CG1964-RA (Kul), mRNA 
0   NM_140210.1  CG6140-RA (CG6140), mRNA 
0   NM_176460.1  CG31374-RC, transcript variant C (CG31374), mRNA 
0   NM_169391.1  CG31374-RA, transcript variant A (CG31374), mRNA 
0   NM_169390.2  CG31374-RB, transcript variant B (CG31374), mRNA 
0   NM_169376.1  CG6684-RB, transcript variant B (RpS25), mRNA 
0   NM_079591.4  CG6684-RA, transcript variant A (RpS25), mRNA 
0   12  36  NM_144295.1  CG13990-RA (CG13990), mRNA 
0   NM_206771.1  CG33252-RA (CG33252), mRNA 
0   16  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_135075.2  CG14030-RA (CG14030), mRNA 
0   NM_165754.1  CG12214-RB, transcript variant B (CG12214), mRNA 
0   NM_142601.1  CG4845-RA (CG4845), mRNA 
0   NM_137526.1  CG15077-RA (Cyp12b2), mRNA 
0   NM_168811.1  CG32209-RB (CG32209), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.