National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4270R-6 
 Symbol CG4270  Full Name CG4270 
 CG No CG4270  Old CG No CG4270 
 Synonyms BcDNA:AT04879, CG4270 
 Accession No (Link to NCBI) NM_134819.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGAAACGTAGCGCCCATTCCC 
 Primer Seq. 3'
aatctagaggtaccGGCGGCACATTATCCTTGAAC 
 Predicted Fragment Size
494 
 IR fragment full Seq
0001 AGAAACGTAG CGCCCATTCC CAAAACCCAC GAGCGCCCTC CAGGTCCCAG GGGTCAGGAT 
0061 ACCAAGGGCA ACAACGAGCT CTTCCTGAAG GAGGTCTTCA ATACCACCAA TAAATATCGG 
0121 GCAATGCACG GCTGTCCTGC GGTGACCATT AATGCTGCGC TAAATAAGCT GGCTCAGGAA 
0181 TGGGCCAATC ATCTCCGCGA TCAGAACACA ATGGCACACA GACCCAATCC CAAGTACGGC 
0241 GAAAACATTT TCCTCTCCGG TGGAATGGAT GTGACCGGTG ATCTGCCGGT GGAAATGTGG 
0301 TATCGGGAAA TCAATAGCTA CGATTTCAAC AAGGCGCAGT TTGTGCCCAC CGCTGGACAC 
0361 TTTACTCAGC TCATTTGGAA GTCGTCGGTG GAAATGGGTT CGGGTGTGGC CCGAAAAGCG 
0421 GATAGAACTT GGGTGGTTTG CAACTACAAT CCTCCCGGCA ATGTTATGGG TTTGTTCAAG 
0481 GATAANTGNT GNCGcc 
 in silico PCR Fragment
0001 AGAAACGTAG CGCCCATTCC CAAAACCCAC GAGCGCCCTC CAGGTCCCAG GGGTCAGGAT 
0061 ACCAAGGGCA ACAACGAGCT CTTCCTGAAG GAGGTCTTCA ATACCACCAA TAAATATCGG 
0121 GCAATGCACG GCTGTCCCGC GGTGACCATT AATGCTGCAC TAAATAAGCT GGCTCAGGAA 
0181 TGGGCCAATC ATCTCCGCGA TCAGAACACA ATGGCGCACA GACCCAATCC CAAGTACGGC 
0241 GAAAACATTT TCCTCTCCGG TGGAATGGAT GTGACCGGTG ATCTGCCGGT GGAAATGTGG 
0301 TATCGGGAAA TCAATAGCTA CGATTTCAAC AAGGCGCAGT TTGTGCCCAC CGCTGGACAC 
0361 TTTACTCAGC TCATTTGGAA GTCGTCGGTG GAAATGGGTT CGGGTGTGGC CCGAAAAGCG 
0421 GATAGAACTT GGGTGGTTTG CAACTACAAT CCTCCCGGCA ATGTTGTGGG TTTGTTCAAG 
0481 GATAA-TG-T GCCGCC 
 Assemble Data

4270R-6.IR_full       1   AGAAACGTAGCGCCCATTCCCAAAACCCACGAGCGCCCTCCAGGTCCCAGGGGTCAGGAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4270R-6.in silico     1   AGAAACGTAGCGCCCATTCCCAAAACCCACGAGCGCCCTCCAGGTCCCAGGGGTCAGGAT 60


4270R-6.IR_full       61  ACCAAGGGCAACAACGAGCTCTTCCTGAAGGAGGTCTTCAATACCACCAATAAATATCGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4270R-6.in silico     61  ACCAAGGGCAACAACGAGCTCTTCCTGAAGGAGGTCTTCAATACCACCAATAAATATCGG 120


4270R-6.IR_full       121 GCAATGCACGGCTGTCCTGCGGTGACCATTAATGCTGCGCTAAATAAGCTGGCTCAGGAA 180
                          ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||
4270R-6.in silico     121 GCAATGCACGGCTGTCCCGCGGTGACCATTAATGCTGCACTAAATAAGCTGGCTCAGGAA 180


4270R-6.IR_full       181 TGGGCCAATCATCTCCGCGATCAGAACACAATGGCACACAGACCCAATCCCAAGTACGGC 240
                          ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
4270R-6.in silico     181 TGGGCCAATCATCTCCGCGATCAGAACACAATGGCGCACAGACCCAATCCCAAGTACGGC 240


4270R-6.IR_full       241 GAAAACATTTTCCTCTCCGGTGGAATGGATGTGACCGGTGATCTGCCGGTGGAAATGTGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4270R-6.in silico     241 GAAAACATTTTCCTCTCCGGTGGAATGGATGTGACCGGTGATCTGCCGGTGGAAATGTGG 300


4270R-6.IR_full       301 TATCGGGAAATCAATAGCTACGATTTCAACAAGGCGCAGTTTGTGCCCACCGCTGGACAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4270R-6.in silico     301 TATCGGGAAATCAATAGCTACGATTTCAACAAGGCGCAGTTTGTGCCCACCGCTGGACAC 360


4270R-6.IR_full       361 TTTACTCAGCTCATTTGGAAGTCGTCGGTGGAAATGGGTTCGGGTGTGGCCCGAAAAGCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4270R-6.in silico     361 TTTACTCAGCTCATTTGGAAGTCGTCGGTGGAAATGGGTTCGGGTGTGGCCCGAAAAGCG 420


4270R-6.IR_full       421 GATAGAACTTGGGTGGTTTGCAACTACAATCCTCCCGGCAATGTTATGGGTTTGTTCAAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
4270R-6.in silico     421 GATAGAACTTGGGTGGTTTGCAACTACAATCCTCCCGGCAATGTTGTGGGTTTGTTCAAG 480


4270R-6.IR_full       481 GATAANTGNTGNCGCC 496
                          ||||| || || ||||
4270R-6.in silico     481 GATAA-TG-TGCCGCC 496

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   476  NM_134819.2  CG4270-RA, transcript variant A (CG4270), mRNA 
83.61   398  NM_164471.1  CG4270-RB, transcript variant B (CG4270), mRNA 
0   NM_137773.1  CG13493-RA (comr), mRNA 
0   NM_131926.1  CG15570-RA (CG15570), mRNA 
0   NM_166262.1  CG5756-RB, transcript variant B (CG5756), mRNA 
0   NM_137448.2  CG5756-RA, transcript variant A (CG5756), mRNA 
0   NM_132371.1  CG15314-RA (CG15314), mRNA 
0   10  NM_134824.2  CG16995-RA (CG16995), mRNA 
0   NM_140914.2  CG7749-RA, transcript variant A (fat2), mRNA 
0   NM_001031967.1  CG7749-RB, transcript variant B (fat2), mRNA 
0   NM_057548.3  CG10385-RA (msl-1), mRNA 
0   NM_144357.2  CG13475-RA (HGTX), mRNA 
0   29  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_176738.1  CG33172-RA (CG33172), mRNA 
0   NM_079877.2  CG17245-RA (plexB), mRNA 
0   NM_001032090.1  CG33697-RA (CG33697), mRNA 
0   NM_142106.1  CG14843-RA (CG14843), mRNA 
0   NM_137235.2  CG8399-RA (CG8399), mRNA 
0   NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_078878.2  CG10123-RA (Top3alpha), mRNA 
0   NM_165163.1  CG4952-RE, transcript variant E (dac), mRNA 
0   NM_135341.1  CG8552-RA (CG8552), mRNA 
0   NM_001014487.1  CG4952-RF, transcript variant F (dac), mRNA 
0   NM_165161.1  CG4952-RD, transcript variant D (dac), mRNA 
0   NM_165162.1  CG4952-RB, transcript variant B (dac), mRNA 
0   NM_001014486.1  CG4952-RG, transcript variant G (dac), mRNA 
0   NM_165159.1  CG4952-RC, transcript variant C (dac), mRNA 
0   NM_165160.1  CG4952-RA, transcript variant A (dac), mRNA 
0   NM_079012.2  CG8085-RB, transcript variant B (RN-tre), mRNA 
0   NR_001596.1  CR32011, mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.