National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4270R-3 
 Symbol CG4270  Full Name CG4270 
 CG No CG4270  Old CG No CG4270 
 Synonyms BcDNA:AT04879, CG4270 
 Accession No (Link to NCBI) NM_134819.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGAAACGTAGCGCCCATTCCCAAAACCCACGAGCGCCCTCCAGGTCCCAGGGGTCAGGAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACCAAGGGCAACAACGAGCTCTTCCTGAAGGAGGTCTTCAATACCACCAATAAATATCGG 120

                          ||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| silico     121 GCAATGCACGGCTGTCCCGCGGTGACCATTAATGCTGCACTAAATAAGCTGGCTCAGGAA 180

                          ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| silico     181 TGGGCCAATCATCTCCGCGATCAGAACACAATGGCGCACAGACCCAATCCCAAGTACGGC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GAAAACATTTTCCTCTCCGGTGGAATGGATGTGACCGGTGATCTGCCGGTGGAAATGTGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TATCGGGAAATCAATAGCTACGATTTCAACAAGGCGCAGTTTGTGCCCACCGCTGGACAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTTACTCAGCTCATTTGGAAGTCGTCGGTGGAAATGGGTTCGGGTGTGGCCCGAAAAGCG 420

                          ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| silico     421 GATAGAACTTGGGTGGTTTGCAACTACAATCCTCCCGGCAATGTTGTGGGTTTGTTCAAG 480

4270R-3.IR_full       481 GATAANTGNTGNCGCC 496
                          ||||| || || |||| silico     481 GATAA-TG-TGCCGCC 496

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   476  NM_134819.2  CG4270-RA, transcript variant A (CG4270), mRNA 
83.61   398  NM_164471.1  CG4270-RB, transcript variant B (CG4270), mRNA 
0   NM_137773.1  CG13493-RA (comr), mRNA 
0   NM_131926.1  CG15570-RA (CG15570), mRNA 
0   NM_166262.1  CG5756-RB, transcript variant B (CG5756), mRNA 
0   NM_137448.2  CG5756-RA, transcript variant A (CG5756), mRNA 
0   NM_132371.1  CG15314-RA (CG15314), mRNA 
0   10  NM_134824.2  CG16995-RA (CG16995), mRNA 
0   NM_140914.2  CG7749-RA, transcript variant A (fat2), mRNA 
0   NM_001031967.1  CG7749-RB, transcript variant B (fat2), mRNA 
0   NM_057548.3  CG10385-RA (msl-1), mRNA 
0   NM_144357.2  CG13475-RA (HGTX), mRNA 
0   29  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_176738.1  CG33172-RA (CG33172), mRNA 
0   NM_079877.2  CG17245-RA (plexB), mRNA 
0   NM_001032090.1  CG33697-RA (CG33697), mRNA 
0   NM_142106.1  CG14843-RA (CG14843), mRNA 
0   NM_137235.2  CG8399-RA (CG8399), mRNA 
0   NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_078878.2  CG10123-RA (Top3alpha), mRNA 
0   NM_165163.1  CG4952-RE, transcript variant E (dac), mRNA 
0   NM_135341.1  CG8552-RA (CG8552), mRNA 
0   NM_001014487.1  CG4952-RF, transcript variant F (dac), mRNA 
0   NM_165161.1  CG4952-RD, transcript variant D (dac), mRNA 
0   NM_165162.1  CG4952-RB, transcript variant B (dac), mRNA 
0   NM_001014486.1  CG4952-RG, transcript variant G (dac), mRNA 
0   NM_165159.1  CG4952-RC, transcript variant C (dac), mRNA 
0   NM_165160.1  CG4952-RA, transcript variant A (dac), mRNA 
0   NM_079012.2  CG8085-RB, transcript variant B (RN-tre), mRNA 
0   NR_001596.1  CR32011, mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.