National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4262R-4 
 Symbol elav  Full Name embryonic lethal, abnormal vision 
 CG No CG4262  Old CG No CG4262 
 Synonyms ELAV, Elav, ElaV, Elav-9F8A9, 9F8A9, CG4262, EG:65F1.2, l(1)G0319, l(1)G0031, l(1)1Be, elav-3, elav-2, elav-1, EC7, l(1)EC7, fliJ, 44C11, elav 
 Accession No (Link to NCBI) NM_080294.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCGGAGTAGACACACAGGCA 
 Primer Seq. 3'
aatctagaggtaccACCGACTCAATCTCGCCGACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 gGNGNAGTAG ACACACAGGC ACAGCTAATG CAGAGTGCCG CTGCAGCCGC aGCANTGGCg 
0061 GCAACAAACG CGGCCGcCGC TCCCGTACAG AATGCAGCCG CCGTNGCggc cgNCGCCCAG 
0121 CTGCAGCAGC AACAGGTGCA ACAGGCAATC CTGCAGGTGC AGCAGCAGCN AGACACAGCA 
0181 AGCGGTCGGC cgCGGCCGCT GCCGCAGNTG NACCCAGCAG CTCCAACAGC AACAGCAGGC 
0241 TGTCGTGGCC CAACAGGCTG TAGTGCAGCA GCAACAACAG CAGGCGGCGG CAGTGGTGCA 
0301 ACAGGCGGCG GTCCAACAGG CTGTGGTGCC CCAGCCGCAG CAGGCGCAGC CCAATACGAA 
0361 TGGCAATGCA GGATCGGGAT CGCAAAATGG CAGCAACGGC AGCACGGAGA CGCGCACAAA 
0421 CCTTATTGTC AACTACTTGC CGCAAACAAT GACCGAAGAC GAGATCCGTT CGCTCTTCTC 
0481 CAGCGTCGGC GAGATTGATG TCGGt 
 in silico PCR Fragment
0001 GGCGGAGTAG ACACACAGGC ACAGCTAATG CAGAGTGCCG CTGCAGCCGC AGCAGTGGCG 
0061 GCAACAAACG CGGCCGCCGC TCCCGTACAG AATGCAGCCG CCGTGGCGGC CGCCGCCCAG 
0121 CTGCAGCAGC AACAGGTGCA ACAGGCAATC CTGCAGGTGC AGCAGCAGC- AGACACAGCA 
0181 AGCGGT-GGC CGCGGCCGCT GCCGCAG-TG -ACCCAGCAG CTCCAACAGC AACAGCAGGC 
0241 TGTCGTGGCC CAACAGGCTG TAGTGCAGCA GCAACAACAG CAGGCGGCGG CAGTGGTGCA 
0301 ACAGGCGGCG GTCCAACAGG CTGTGGTGCC CCAGCCGCAG CAGGCGCAGC CCAATACGAA 
0361 TGGCAATGCA GGATCGGGAT CGCAAAATGG CAGCAACGGC AGCACGGAGA CGCGCACAAA 
0421 CCTTATTGTC AACTACTTGC CGCAAACAAT GACCGAAGAC GAGATCCGTT CGCTCTTCTC 
0481 CAGCGTCGGC GAGATTGA-G TCGGT 
 Assemble Data

4262R-4.IR_full       1   GGNGNAGTAGACACACAGGCACAGCTAATGCAGAGTGCCGCTGCAGCCGCAGCANTGGCG 60
                          || | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||
4262R-4.in silico     1   GGCGGAGTAGACACACAGGCACAGCTAATGCAGAGTGCCGCTGCAGCCGCAGCAGTGGCG 60


4262R-4.IR_full       61  GCAACAAACGCGGCCGCCGCTCCCGTACAGAATGCAGCCGCCGTNGCGGCCGNCGCCCAG 120
                          |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||
4262R-4.in silico     61  GCAACAAACGCGGCCGCCGCTCCCGTACAGAATGCAGCCGCCGTGGCGGCCGCCGCCCAG 120


4262R-4.IR_full       121 CTGCAGCAGCAACAGGTGCAACAGGCAATCCTGCAGGTGCAGCAGCAGCNAGACACAGCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
4262R-4.in silico     121 CTGCAGCAGCAACAGGTGCAACAGGCAATCCTGCAGGTGCAGCAGCAGC-AGACACAGCA 180


4262R-4.IR_full       181 AGCGGTCGGCCGCGGCCGCTGCCGCAGNTGNACCCAGCAGCTCCAACAGCAACAGCAGGC 240
                          |||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||
4262R-4.in silico     181 AGCGGT-GGCCGCGGCCGCTGCCGCAG-TG-ACCCAGCAGCTCCAACAGCAACAGCAGGC 240


4262R-4.IR_full       241 TGTCGTGGCCCAACAGGCTGTAGTGCAGCAGCAACAACAGCAGGCGGCGGCAGTGGTGCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4262R-4.in silico     241 TGTCGTGGCCCAACAGGCTGTAGTGCAGCAGCAACAACAGCAGGCGGCGGCAGTGGTGCA 300


4262R-4.IR_full       301 ACAGGCGGCGGTCCAACAGGCTGTGGTGCCCCAGCCGCAGCAGGCGCAGCCCAATACGAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4262R-4.in silico     301 ACAGGCGGCGGTCCAACAGGCTGTGGTGCCCCAGCCGCAGCAGGCGCAGCCCAATACGAA 360


4262R-4.IR_full       361 TGGCAATGCAGGATCGGGATCGCAAAATGGCAGCAACGGCAGCACGGAGACGCGCACAAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4262R-4.in silico     361 TGGCAATGCAGGATCGGGATCGCAAAATGGCAGCAACGGCAGCACGGAGACGCGCACAAA 420


4262R-4.IR_full       421 CCTTATTGTCAACTACTTGCCGCAAACAATGACCGAAGACGAGATCCGTTCGCTCTTCTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4262R-4.in silico     421 CCTTATTGTCAACTACTTGCCGCAAACAATGACCGAAGACGAGATCCGTTCGCTCTTCTC 480


4262R-4.IR_full       481 CAGCGTCGGCGAGATTGATGTCGGT 505
                          |||||||||||||||||| ||||||
4262R-4.in silico     481 CAGCGTCGGCGAGATTGA-GTCGGT 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  45  NM_080294.3  CG18255-RD, transcript variant D (Strn-Mlck), mRNA, abnormal vision CG4262-RA, transcript variant A (elav), mRNA 
100   482  45  NM_001014713.1  CG18255-RD, transcript variant D (Strn-Mlck), mRNA, abnormal vision CG4262-RA, transcript variant A (elav), mRNA, abnormal vision CG4262-RB, transcript variant B (elav), mRNA 
1.86   15  97  NM_079818.2  CG10002-RA (fkh), mRNA 
1.45   29  143  352  NM_132525.1  CG15740-RA (CG15740), mRNA 
1.24   58  NM_135651.2  CG4751-RA (CG4751), mRNA 
1.03   26  245  1425  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
1.03   26  245  1425  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
1.03   26  245  1425  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
1.03   13  56  254  NM_132004.2  CG4136-RA (CG4136), mRNA 
0.82   16  55  339  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
0.82   16  55  339  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
0.82   16  55  339  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0.62   17  106  437  NM_135077.2  CG14023-RA (CG14023), mRNA 
0.62   12  64  285  NM_168179.1  CG32394-RA (CG32394), mRNA 
0.62   12  61  313  NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
0.62   11  51  207  NM_166992.2  CG2904-RA (ec), mRNA 
0.62   10  74  467  NM_168571.2  CG32133-RA (CG32133), mRNA 
0.62   10  23  87  NM_132328.1  CG17446-RA (CG17446), mRNA 
0.62   24  NM_169013.1  CG1057-RB, transcript variant B (MED31), mRNA 
0.62   24  NM_141226.2  CG1057-RA, transcript variant A (MED31), mRNA 
0.62   12  43  NM_136917.2  CG8487-RB, transcript variant B (garz), mRNA 
0.62   19  NM_079962.3  CG18042-RA (lmg), mRNA 
0.62   NM_166465.1  CG9856-RA (PTP-ER), mRNA 
0.41   24  54  202  NM_132126.1  CG3075-RA (CG3075), mRNA 
0.41   19  100  438  NM_079903.2  CG15319-RB (nej), mRNA 
0.41   19  61  351  NM_078797.2  CG13109-RA (tai), mRNA 
0.41   18  105  459  NM_139493.2  CG2083-RA (CG2083), mRNA 
0.41   17  82  320  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0.41   17  82  320  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0.41   15  61  294  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.