National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4262R-1 
 Symbol elav  Full Name embryonic lethal, abnormal vision 
 CG No CG4262  Old CG No CG4262 
 Synonyms ELAV, Elav, ElaV, Elav-9F8A9, 9F8A9, CG4262, EG:65F1.2, l(1)G0319, l(1)G0031, l(1)1Be, elav-3, elav-2, elav-1, EC7, l(1)EC7, fliJ, 44C11, elav 
 Accession No (Link to NCBI) NM_080294.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male semi-lethal, female lethal 
 Map Viewer
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          || | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     1   GGCGGAGTAGACACACAGGCACAGCTAATGCAGAGTGCCGCTGCAGCCGCAGCAGTGGCG 60

                          |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| silico     61  GCAACAAACGCGGCCGCCGCTCCCGTACAGAATGCAGCCGCCGTGGCGGCCGCCGCCCAG 120

                          ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| silico     121 CTGCAGCAGCAACAGGTGCAACAGGCAATCCTGCAGGTGCAGCAGCAGC-AGACACAGCA 180

                          |||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||| silico     181 AGCGGT-GGCCGCGGCCGCTGCCGCAG-TG-ACCCAGCAGCTCCAACAGCAACAGCAGGC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGTCGTGGCCCAACAGGCTGTAGTGCAGCAGCAACAACAGCAGGCGGCGGCAGTGGTGCA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACAGGCGGCGGTCCAACAGGCTGTGGTGCCCCAGCCGCAGCAGGCGCAGCCCAATACGAA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGGCAATGCAGGATCGGGATCGCAAAATGGCAGCAACGGCAGCACGGAGACGCGCACAAA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCTTATTGTCAACTACTTGCCGCAAACAATGACCGAAGACGAGATCCGTTCGCTCTTCTC 480

                          |||||||||||||||||| |||||| silico     481 CAGCGTCGGCGAGATTGA-GTCGGT 505

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  45  NM_080294.3  CG18255-RD, transcript variant D (Strn-Mlck), mRNA, abnormal vision CG4262-RA, transcript variant A (elav), mRNA 
100   482  45  NM_001014713.1  CG18255-RD, transcript variant D (Strn-Mlck), mRNA, abnormal vision CG4262-RA, transcript variant A (elav), mRNA, abnormal vision CG4262-RB, transcript variant B (elav), mRNA 
1.86   15  97  NM_079818.2  CG10002-RA (fkh), mRNA 
1.45   29  143  352  NM_132525.1  CG15740-RA (CG15740), mRNA 
1.24   58  NM_135651.2  CG4751-RA (CG4751), mRNA 
1.03   26  245  1425  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
1.03   26  245  1425  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
1.03   26  245  1425  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
1.03   13  56  254  NM_132004.2  CG4136-RA (CG4136), mRNA 
0.82   16  55  339  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
0.82   16  55  339  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
0.82   16  55  339  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0.62   17  106  437  NM_135077.2  CG14023-RA (CG14023), mRNA 
0.62   12  64  285  NM_168179.1  CG32394-RA (CG32394), mRNA 
0.62   12  61  313  NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
0.62   11  51  207  NM_166992.2  CG2904-RA (ec), mRNA 
0.62   10  74  467  NM_168571.2  CG32133-RA (CG32133), mRNA 
0.62   10  23  87  NM_132328.1  CG17446-RA (CG17446), mRNA 
0.62   24  NM_169013.1  CG1057-RB, transcript variant B (MED31), mRNA 
0.62   24  NM_141226.2  CG1057-RA, transcript variant A (MED31), mRNA 
0.62   12  43  NM_136917.2  CG8487-RB, transcript variant B (garz), mRNA 
0.62   19  NM_079962.3  CG18042-RA (lmg), mRNA 
0.62   NM_166465.1  CG9856-RA (PTP-ER), mRNA 
0.41   24  54  202  NM_132126.1  CG3075-RA (CG3075), mRNA 
0.41   19  100  438  NM_079903.2  CG15319-RB (nej), mRNA 
0.41   19  61  351  NM_078797.2  CG13109-RA (tai), mRNA 
0.41   18  105  459  NM_139493.2  CG2083-RA (CG2083), mRNA 
0.41   17  82  320  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0.41   17  82  320  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0.41   15  61  294  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.