National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4192R-3 
 Symbol kek3  Full Name kekkon-3 
 CG No CG4192  Old CG No CG4192 
 Synonyms CT12629, BG:DS04862.1, CG4192, kek3 
 Accession No (Link to NCBI) NM_078851.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
 Reference
[Please submit your publication]
Xu C, Franklin B, Tang HW, Regimbald-Dumas Y, Hu Y, Ramos J, Bosch JA, Villalta C, He X, Perrimon N.
An in vivo RNAi screen uncovers the role of AdoR signaling and adenosine deaminase in controlling intestinal stem cell activity.
Proc Natl Acad Sci U S A (2020) 117(1) 464-471 [ PubMed ID = 31852821 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCAGGACATAGCCAGCGACA 
 Primer Seq. 3'
aatctagaggtaccAGGGTATTGCCGAGAGCAGGT 
 Predicted Fragment Size
477 
 IR fragment full Seq
0001 GTCAGGACAT AGCCAGCGAC AACAGCGCGC CAGcGCCGCA CGCTGGCGAC GAAGGTGCGT 
0061 CGAAAAGGGC CACGCCCCCA ACGGCGCCTG CACCCGCCCC TGCGCCCTCG NCTGCCGCTC 
0121 CATTTGCACC TGCTACTCTG GCTGCTGTGC TGCTGTTCTC AGCTGGGCCA GCTGAGGGCC 
0181 GAGTGTCCAG CGGTGTGCGA GTGCAAGTGG AAGAGTGGCA AGGAGTCCGT CTTGTGCCTT 
0241 AACGCCAACC TAACCCACAT CCCGCAGCCG CTGGACGCGG GAACTCAGTT GCTGGACCTT 
0301 AGCGGCAATG AGATCCAACT AATACCCGAC GATAGCTTCG CAACCGCCCA GTTGCTCAAC 
0361 CTACAGAAGG TGTACCTGGC CAGGTGTCAC CTTCGGCTTA TCGAACGCCA TGCCTTCCGT 
0421 AAGCTGATCA ATCTAGTGGA ACTGGATCTA AGCCAGAACC TGCTCTCGGC AATACCCT 
 in silico PCR Fragment
0001 GTCAGGACAT AGCCAGCGAC AACAGCGC-C CAGCGCCGCA CGCTGGCGAC GAAGGTGCGT 
0061 CGAAAAGGGC CACGCCCCCA ACGGCGCCTG CACCCGCCCC TGCGCCCTCG CCTGCCGCTC 
0121 CATTTGCACC TGCTACTCTG GCTGCTGTGC TGCTGTTCTC AGCTGGGCCA GCTGAGGGCC 
0181 GAGTGTCCAG CGGTGTGCGA GTGCAAGTGG AAGAGTGGCA AGGAGTCCGT CTTGTGCCTT 
0241 AACGCCAACC TAACCCACAT CCCGCAGCCG CTGGACGCGG GAACTCAGTT GCTGGACCTT 
0301 AGCGGCAATG AGATCCAACT AATACCCGAC GATAGCTTCG CAACCGCCCA GTTGCTCAAC 
0361 CTACAGAAGG TGTACCTGGC CAGGTGTCAC CTCCGGCTTA TCGAACGCCA TGCCTTCCGT 
0421 AAGCTGATCA ATCTAGTGGA ACTGGATCTA AGCCAGAACC TGCTCTCGGC AATACCCT 
 Assemble Data

4192R-3.IR_full       1   GTCAGGACATAGCCAGCGACAACAGCGCGCCAGCGCCGCACGCTGGCGACGAAGGTGCGT 60
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
4192R-3.in silico     1   GTCAGGACATAGCCAGCGACAACAGCGC-CCAGCGCCGCACGCTGGCGACGAAGGTGCGT 60


4192R-3.IR_full       61  CGAAAAGGGCCACGCCCCCAACGGCGCCTGCACCCGCCCCTGCGCCCTCGNCTGCCGCTC 120
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
4192R-3.in silico     61  CGAAAAGGGCCACGCCCCCAACGGCGCCTGCACCCGCCCCTGCGCCCTCGCCTGCCGCTC 120


4192R-3.IR_full       121 CATTTGCACCTGCTACTCTGGCTGCTGTGCTGCTGTTCTCAGCTGGGCCAGCTGAGGGCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4192R-3.in silico     121 CATTTGCACCTGCTACTCTGGCTGCTGTGCTGCTGTTCTCAGCTGGGCCAGCTGAGGGCC 180


4192R-3.IR_full       181 GAGTGTCCAGCGGTGTGCGAGTGCAAGTGGAAGAGTGGCAAGGAGTCCGTCTTGTGCCTT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4192R-3.in silico     181 GAGTGTCCAGCGGTGTGCGAGTGCAAGTGGAAGAGTGGCAAGGAGTCCGTCTTGTGCCTT 240


4192R-3.IR_full       241 AACGCCAACCTAACCCACATCCCGCAGCCGCTGGACGCGGGAACTCAGTTGCTGGACCTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4192R-3.in silico     241 AACGCCAACCTAACCCACATCCCGCAGCCGCTGGACGCGGGAACTCAGTTGCTGGACCTT 300


4192R-3.IR_full       301 AGCGGCAATGAGATCCAACTAATACCCGACGATAGCTTCGCAACCGCCCAGTTGCTCAAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4192R-3.in silico     301 AGCGGCAATGAGATCCAACTAATACCCGACGATAGCTTCGCAACCGCCCAGTTGCTCAAC 360


4192R-3.IR_full       361 CTACAGAAGGTGTACCTGGCCAGGTGTCACCTTCGGCTTATCGAACGCCATGCCTTCCGT 420
                          |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
4192R-3.in silico     361 CTACAGAAGGTGTACCTGGCCAGGTGTCACCTCCGGCTTATCGAACGCCATGCCTTCCGT 420


4192R-3.IR_full       421 AAGCTGATCAATCTAGTGGAACTGGATCTAAGCCAGAACCTGCTCTCGGCAATACCCT 478
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4192R-3.in silico     421 AAGCTGATCAATCTAGTGGAACTGGATCTAAGCCAGAACCTGCTCTCGGCAATACCCT 478

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   459  NM_078851.2  CG4192-RA (kek3), mRNA 
0   NM_167101.1  CG3039-RB, transcript variant B (ogre), mRNA 
0   NM_080085.2  CG3039-RA, transcript variant A (ogre), mRNA 
0   15  NM_078835.2  CG12283-RA (kek1), mRNA 
0   NM_134498.2  CG14216-RA (CG14216), mRNA 
0   NM_138037.1  CG10339-RA (CG10339), mRNA 
0   NM_137394.1  CG11423-RA (CG11423), mRNA 
0   16  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_169450.1  CG14741-RA (CG14741), mRNA 
0   NM_135675.2  CG14939-RA (CG14939), mRNA 
0   NM_165555.1  CG30497-RB, transcript variant B (CG30497), mRNA 
0   NM_135910.1  CG15256-RA (CG15256), mRNA 
0   NM_132804.1  CG9203-RA (CG9203), mRNA 
0   NM_079668.2  CG7467-RB, transcript variant B (osa), mRNA 
0   NM_169775.1  CG7467-RA, transcript variant A (osa), mRNA 
0   NM_206506.1  CG7467-RC, transcript variant C (osa), mRNA 
0   NM_169504.1  CG32473-RC, transcript variant C (CG32473), mRNA 
0   NM_142019.2  CG32473-RB, transcript variant B (CG32473), mRNA 
0   14  NM_167627.1  CG6659-RB, transcript variant B (CG6659), mRNA 
0   14  NM_133089.2  CG6659-RA, transcript variant A (CG6659), mRNA 
0   NM_169816.1  CG14307-RB, transcript variant B (fru), mRNA 
0   NM_079673.2  CG14307-RF, transcript variant F (fru), mRNA 
0   NM_078963.2  CG7576-RA (Rab3), mRNA 
0   NM_079747.2  CG5394-RA, transcript variant A (Aats-glupro), mRNA 
0   NM_170103.1  CG5394-RB, transcript variant B (Aats-glupro), mRNA 
0   NM_136137.2  CG10137-RA (CG10137), mRNA 
0   NM_132103.2  CG3973-RA (CG3973), mRNA 
0   NM_206516.1  CG14307-RI, transcript variant I (fru), mRNA 
0   NM_206515.1  CG14307-RJ, transcript variant J (fru), mRNA 
0   NM_169819.1  CG14307-RE, transcript variant E (fru), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.