National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4192R-2 
 Symbol kek3  Full Name kekkon-3 
 CG No CG4192  Old CG No CG4192 
 Synonyms CT12629, BG:DS04862.1, CG4192, kek3 
 Accession No (Link to NCBI) NM_078851.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| silico     1   GTCAGGACATAGCCAGCGACAACAGCGC-CCAGCGCCGCACGCTGGCGACGAAGGTGCGT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     61  CGAAAAGGGCCACGCCCCCAACGGCGCCTGCACCCGCCCCTGCGCCCTCGCCTGCCGCTC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CATTTGCACCTGCTACTCTGGCTGCTGTGCTGCTGTTCTCAGCTGGGCCAGCTGAGGGCC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGTGTCCAGCGGTGTGCGAGTGCAAGTGGAAGAGTGGCAAGGAGTCCGTCTTGTGCCTT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AACGCCAACCTAACCCACATCCCGCAGCCGCTGGACGCGGGAACTCAGTTGCTGGACCTT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGCGGCAATGAGATCCAACTAATACCCGACGATAGCTTCGCAACCGCCCAGTTGCTCAAC 360

                          |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     361 CTACAGAAGGTGTACCTGGCCAGGTGTCACCTCCGGCTTATCGAACGCCATGCCTTCCGT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAGCTGATCAATCTAGTGGAACTGGATCTAAGCCAGAACCTGCTCTCGGCAATACCCT 478

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   459  NM_078851.2  CG4192-RA (kek3), mRNA 
0   NM_167101.1  CG3039-RB, transcript variant B (ogre), mRNA 
0   NM_080085.2  CG3039-RA, transcript variant A (ogre), mRNA 
0   15  NM_078835.2  CG12283-RA (kek1), mRNA 
0   NM_134498.2  CG14216-RA (CG14216), mRNA 
0   NM_138037.1  CG10339-RA (CG10339), mRNA 
0   NM_137394.1  CG11423-RA (CG11423), mRNA 
0   16  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_169450.1  CG14741-RA (CG14741), mRNA 
0   NM_135675.2  CG14939-RA (CG14939), mRNA 
0   NM_165555.1  CG30497-RB, transcript variant B (CG30497), mRNA 
0   NM_135910.1  CG15256-RA (CG15256), mRNA 
0   NM_132804.1  CG9203-RA (CG9203), mRNA 
0   NM_079668.2  CG7467-RB, transcript variant B (osa), mRNA 
0   NM_169775.1  CG7467-RA, transcript variant A (osa), mRNA 
0   NM_206506.1  CG7467-RC, transcript variant C (osa), mRNA 
0   NM_169504.1  CG32473-RC, transcript variant C (CG32473), mRNA 
0   NM_142019.2  CG32473-RB, transcript variant B (CG32473), mRNA 
0   14  NM_167627.1  CG6659-RB, transcript variant B (CG6659), mRNA 
0   14  NM_133089.2  CG6659-RA, transcript variant A (CG6659), mRNA 
0   NM_169816.1  CG14307-RB, transcript variant B (fru), mRNA 
0   NM_079673.2  CG14307-RF, transcript variant F (fru), mRNA 
0   NM_078963.2  CG7576-RA (Rab3), mRNA 
0   NM_079747.2  CG5394-RA, transcript variant A (Aats-glupro), mRNA 
0   NM_170103.1  CG5394-RB, transcript variant B (Aats-glupro), mRNA 
0   NM_136137.2  CG10137-RA (CG10137), mRNA 
0   NM_132103.2  CG3973-RA (CG3973), mRNA 
0   NM_206516.1  CG14307-RI, transcript variant I (fru), mRNA 
0   NM_206515.1  CG14307-RJ, transcript variant J (fru), mRNA 
0   NM_169819.1  CG14307-RE, transcript variant E (fru), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.