National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4163R-2 
 Symbol Cyp303a1  Full Name Cyp303a1 
 CG No CG4163  Old CG No CG4163 
 Synonyms CYP303A1-Dm, nompH, 303a1, l(2)35Fb, I(2)35Fb, BG:DS02740.6, CG4163, Cyp303a1 
 Accession No (Link to NCBI) NM_143813.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCCATCTTGTTTGGAGGAGT 
 Primer Seq. 3'
aatctagaggtaccGGTCGTGCATTTCAATCCTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGCCATCTTG TTTGGAGGAG TTCGGAAGCC CAAGCGATTT CCGCCCGGAC CTGCCTGGTA 
0061 TCCCATTGTG GGTAGCGCCC TGCAGGTTTC CCAACTTCGG TGTCGCCTGG GCATGTTTTG 
0121 CAAGGTGATC GACGTGTTTG CCAGGCAGTA TGTGAATCCC TATGGCTTCT ATGGCCTCAA 
0181 GATTGGCAAG GATAAGGTGG TGATAGCCTA TACGAACGAT GCCATCAGTG AAATGATGAC 
0241 CAACGAAGAT ATTGACGGCC GTCCCGATGG CATATTCTAT CGCCTGAGAA CCTTCAATTN 
0301 CCCGATTGGG CGTACTTCTG ACAGACGGTG AGATGTGGGT GGAGCAGCGT AGATTCATTC 
0361 TGAGGCATTT GAAGAACTTT GGCTTTGCTA GAAGTGGCAT GATGGATATA GTGCACAATG 
0421 AGGCCACGTG TTTGCTGCAG GACTTGAAGG ACAAGGTGCT GAAATCAGGC GGAAAGCAGA 
0481 CGAGGATTGA AATGCACGAC C 
 in silico PCR Fragment
0001 GGCCATCTTG TTTGGAGGAG TTCGGAAGCC CAAGCGATTT CCGCCCGGAC CTGCCTGGTA 
0061 TCCCATTGTG GGTAGCGCCC TGCAGGTTTC CCAACTTCGG TGTCGCCTGG GCATGTTTTG 
0121 CAAGGTGATC GATGTGTTTG CCAGGCAGTA TGTGAATCCC TATGGCTTCT ATGGCCTCAA 
0181 GATTGGCAAG GATAAGGTGG TGATAGCCTA TACGAACGAT GCCATCAGTG AAATGATGAC 
0241 CAACGAAGAT ATTGACGGTC GTCCCGATGG CATATTCTAT CGCCTGAGAA CCTTCAATT- 
0301 CCCGATTGGG CGTACTTCTG ACAGACGGTG AGATGTGGGT GGAGCAGCGT AGATTCATTC 
0361 TGAGGCATCT GAAGAACTTT GGCTTTGCTA GAAGTGGCAT GATGGATATA GTGCACAATG 
0421 AGGCCACGTG CTTGCTGCAG GACTTGAAGG ACAAGGTGCT GAAATCAGGC GGAAAGCAGA 
0481 CGAGGATTGA AATGCACGAC C 
 Assemble Data

4163R-2.IR_full       1   GGCCATCTTGTTTGGAGGAGTTCGGAAGCCCAAGCGATTTCCGCCCGGACCTGCCTGGTA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4163R-2.in silico     1   GGCCATCTTGTTTGGAGGAGTTCGGAAGCCCAAGCGATTTCCGCCCGGACCTGCCTGGTA 60


4163R-2.IR_full       61  TCCCATTGTGGGTAGCGCCCTGCAGGTTTCCCAACTTCGGTGTCGCCTGGGCATGTTTTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4163R-2.in silico     61  TCCCATTGTGGGTAGCGCCCTGCAGGTTTCCCAACTTCGGTGTCGCCTGGGCATGTTTTG 120


4163R-2.IR_full       121 CAAGGTGATCGACGTGTTTGCCAGGCAGTATGTGAATCCCTATGGCTTCTATGGCCTCAA 180
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
4163R-2.in silico     121 CAAGGTGATCGATGTGTTTGCCAGGCAGTATGTGAATCCCTATGGCTTCTATGGCCTCAA 180


4163R-2.IR_full       181 GATTGGCAAGGATAAGGTGGTGATAGCCTATACGAACGATGCCATCAGTGAAATGATGAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4163R-2.in silico     181 GATTGGCAAGGATAAGGTGGTGATAGCCTATACGAACGATGCCATCAGTGAAATGATGAC 240


4163R-2.IR_full       241 CAACGAAGATATTGACGGCCGTCCCGATGGCATATTCTATCGCCTGAGAACCTTCAATTN 300
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| 
4163R-2.in silico     241 CAACGAAGATATTGACGGTCGTCCCGATGGCATATTCTATCGCCTGAGAACCTTCAATT- 300


4163R-2.IR_full       301 CCCGATTGGGCGTACTTCTGACAGACGGTGAGATGTGGGTGGAGCAGCGTAGATTCATTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4163R-2.in silico     301 CCCGATTGGGCGTACTTCTGACAGACGGTGAGATGTGGGTGGAGCAGCGTAGATTCATTC 360


4163R-2.IR_full       361 TGAGGCATTTGAAGAACTTTGGCTTTGCTAGAAGTGGCATGATGGATATAGTGCACAATG 420
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
4163R-2.in silico     361 TGAGGCATCTGAAGAACTTTGGCTTTGCTAGAAGTGGCATGATGGATATAGTGCACAATG 420


4163R-2.IR_full       421 AGGCCACGTGTTTGCTGCAGGACTTGAAGGACAAGGTGCTGAAATCAGGCGGAAAGCAGA 480
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
4163R-2.in silico     421 AGGCCACGTGCTTGCTGCAGGACTTGAAGGACAAGGTGCTGAAATCAGGCGGAAAGCAGA 480


4163R-2.IR_full       481 CGAGGATTGAAATGCACGACC 501
                          |||||||||||||||||||||
4163R-2.in silico     481 CGAGGATTGAAATGCACGACC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143813.1  CG4163-RA (Cyp303a1), mRNA 
0   NM_133087.1  CG6617-RA (CG6617), mRNA 
0   NM_135239.1  CG18304-RA (CG18304), mRNA 
0   NM_168369.1  CG8177-RG, transcript variant G (CG8177), mRNA 
0   NM_168372.1  CG8177-RF, transcript variant F (CG8177), mRNA 
0   NM_168371.1  CG8177-RC, transcript variant C (CG8177), mRNA 
0   NM_206314.1  CG8177-RH, transcript variant H (CG8177), mRNA 
0   NM_206311.1  CG8177-RK, transcript variant K (CG8177), mRNA 
0   NM_206312.1  CG8177-RJ, transcript variant J (CG8177), mRNA 
0   NM_206313.1  CG8177-RI, transcript variant I (CG8177), mRNA 
0   NM_140100.1  CG8177-RA, transcript variant A (CG8177), mRNA 
0   NM_168370.1  CG8177-RB, transcript variant B (CG8177), mRNA 
0   NM_168373.1  CG8177-RE, transcript variant E (CG8177), mRNA 
0   NM_168374.1  CG8177-RD, transcript variant D (CG8177), mRNA 
0   NM_001038941.1  CG13380-RB (CG13380), mRNA 
0   NM_001038943.1  CG4174-RB, transcript variant B (CG4174), mRNA 
0   NM_132768.2  CG9057-RA, transcript variant A (Lsd-2), mRNA 
0   NM_001042811.1  CG9057-RB, transcript variant B (Lsd-2), mRNA 
0   NM_079356.2  CG18492-RA (Tak1), mRNA 
0   NM_001042812.1  CG9057-RC, transcript variant C (Lsd-2), mRNA 
0   NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_078773.2  CG31628-RA, transcript variant A (ade3), mRNA 
0   NM_001015501.1  CG17629-PD.3 (CG17629), mRNA 
0   NM_140573.4  CG32156-RE, transcript variant E (Mbs), mRNA 
0   NM_141649.1  CG9388-RA (AP-47), mRNA 
0   NM_057249.4  CG7793-RA (Sos), mRNA 
0   NM_001014737.1  CG7107-RG, transcript variant G (up), mRNA 
0   NM_080349.2  CG7107-RA, transcript variant A (up), mRNA 
0   NM_167375.1  CG7107-RB, transcript variant B (up), mRNA 
0   NM_001014738.1  CG7107-RF, transcript variant F (up), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.