National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4152R-2 
 Symbol l(2)35Df  Full Name lethal (2) 35Df 
 CG No CG4152  Old CG No CG4152 
 Synonyms CG4152, cg4152, l.2.35Df, BG:DS09217.2, l(2)k14423, l(2)br44, br44, l(2)k14422, BcDNA:GH07290, l(2)35Df 
 Accession No (Link to NCBI) NM_080190.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATGAAGTGACGCCGTCGGTG 
 Primer Seq. 3'
aatctagaggtaccTGACGTGTGGGCGGAAACCAG 
 Predicted Fragment Size
498 
 IR fragment full Seq
0001 NATGAAGTGA CGCCGTCGGT GCCGCCACCA GCACTTAACC AGGAGGAGAA GCCATCGGGA 
0061 AGCAGTGCCT CCAAGAAAGG AAATAAGCGC CAAGCNNATG GCACCACTGC ATCGAAAGAA 
0121 GCTACATCCT CCAAAGGAGC GGAGGGCGAT GACAAAGGAG ACGTCACTGA GGAGCCCACC 
0181 AAGCGTCTGA AGCAGGAGGC GTCAACGGTT GCGGTGGATG ACGATAATAA TGCAGATGAC 
0241 GAACCCACTC GTACCCTCGA CATAGACGAT TCCGCGACTC TGGAGGCCCT GCGGACCAGG 
0301 ATTGTCACGC ACTTGTTGGA CGCTCCCAAG TCATGCACCC ACGAGGTTGC CGCCCATCCC 
0361 GACCAGGAGT ACATACCCCT AAAGCCGTTC ANGCGGCGTG CCTGCAAAGG AGTATCCCTT 
0421 CGTCCTCGAT CCGTTCCAGC GCCAGGCGAT TCTGTGCATT GACAACAGCC AGAGTGTGCT 
0481 GGTTTCCGCC CACACGTCA 
 in silico PCR Fragment
0001 GATGAAGTGA CGCCGTCGGT GCCGCCACCA GCACTTAACC AGGAGGAGAA GCCATCGGGA 
0061 AGCAGTGCCT CCAAGAAAGG AAATAAGCGC CAAGCGGATG GCACCACTGC ATCGAAAGAA 
0121 GCTACATCCT CCAAAGGAGC GGAGGGCGAT GACAAAGGAG ACGTCACTGA GGAGCCCACC 
0181 AAGCGTCTGA AGCAGGAGGC GTCAACGGTT GCGGTGGATG ACGATAATAA TGCAGATGAC 
0241 GAACCCACTC GTACCCTCGA CATAGACGAT TCCGCGACTC TGGAGGCCCT GCGGACCAGG 
0301 ATTGTCACGC ACTTGTTGGA CGCTCCCAAG TCATGCACCC ACGAGGTTGC CGCCCATCCC 
0361 GACCAGGAGT ACATACCCCT AAAGCCGTTC A-GCGGCGTG CCTGCAAAGG AGTATCCCTT 
0421 CGTCCTCGAT CCGTTCCAGC GCCAGGCGAT TCTGTGCATT GACAACAGCC AGAGTGTGCT 
0481 GGTTTCCGCC CACACGTCA 
 Assemble Data

4152R-2.IR_full        1   ATGAAGTGACGCCGTCGGTGCCGCCACCAGCACTTAACCAGGAGGAGAAGCCATCGGGA 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4152R-2.in silico      1   ATGAAGTGACGCCGTCGGTGCCGCCACCAGCACTTAACCAGGAGGAGAAGCCATCGGGA 59


4152R-2.IR_full       61  AGCAGTGCCTCCAAGAAAGGAAATAAGCGCCAAGCNNATGGCACCACTGCATCGAAAGAA 119
                          |||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||
4152R-2.in silico     61  AGCAGTGCCTCCAAGAAAGGAAATAAGCGCCAAGCGGATGGCACCACTGCATCGAAAGAA 119


4152R-2.IR_full       121 GCTACATCCTCCAAAGGAGCGGAGGGCGATGACAAAGGAGACGTCACTGAGGAGCCCACC 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4152R-2.in silico     121 GCTACATCCTCCAAAGGAGCGGAGGGCGATGACAAAGGAGACGTCACTGAGGAGCCCACC 179


4152R-2.IR_full       181 AAGCGTCTGAAGCAGGAGGCGTCAACGGTTGCGGTGGATGACGATAATAATGCAGATGAC 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4152R-2.in silico     181 AAGCGTCTGAAGCAGGAGGCGTCAACGGTTGCGGTGGATGACGATAATAATGCAGATGAC 239


4152R-2.IR_full       241 GAACCCACTCGTACCCTCGACATAGACGATTCCGCGACTCTGGAGGCCCTGCGGACCAGG 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4152R-2.in silico     241 GAACCCACTCGTACCCTCGACATAGACGATTCCGCGACTCTGGAGGCCCTGCGGACCAGG 299


4152R-2.IR_full       301 ATTGTCACGCACTTGTTGGACGCTCCCAAGTCATGCACCCACGAGGTTGCCGCCCATCCC 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4152R-2.in silico     301 ATTGTCACGCACTTGTTGGACGCTCCCAAGTCATGCACCCACGAGGTTGCCGCCCATCCC 359


4152R-2.IR_full       361 GACCAGGAGTACATACCCCTAAAGCCGTTCANGCGGCGTGCCTGCAAAGGAGTATCCCTT 419
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
4152R-2.in silico     361 GACCAGGAGTACATACCCCTAAAGCCGTTCA-GCGGCGTGCCTGCAAAGGAGTATCCCTT 419


4152R-2.IR_full       421 CGTCCTCGATCCGTTCCAGCGCCAGGCGATTCTGTGCATTGACAACAGCCAGAGTGTGCT 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4152R-2.in silico     421 CGTCCTCGATCCGTTCCAGCGCCAGGCGATTCTGTGCATTGACAACAGCCAGAGTGTGCT 479


4152R-2.IR_full       481 GGTTTCCGCCCACACGTCA 498
                          |||||||||||||||||||
4152R-2.in silico     481 GGTTTCCGCCCACACGTCA 498

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   480  NM_080190.2  CG4152-RA (l(2)35Df), mRNA 
0   NM_168546.1  CG10732-RA, transcript variant A (CG10732), mRNA 
0   NM_138142.3  CG2790-RA (CG2790), mRNA 
0   NM_167731.1  CG15445-RC, transcript variant C (CG15445), mRNA 
0   NM_167730.1  CG15445-RB, transcript variant B (CG15445), mRNA 
0   NM_134592.2  CG15445-RD, transcript variant D (CG15445), mRNA 
0   NM_167729.1  CG15445-RA, transcript variant A (CG15445), mRNA 
0   NM_164437.2  CG31932-RA (Gr22f), mRNA 
0   NM_134831.1  CG3609-RA (CG3609), mRNA 
0   NM_167218.1  CG32685-RC (CG32685), mRNA 
0   NM_137828.1  CG10972-RA (ppk12), mRNA 
0   NM_168001.1  CG32271-RA (CG32271), mRNA 
0   NM_057814.3  CG12244-RA (lic), mRNA 
0   NM_167387.1  CG32611-RB (CG32611), mRNA 
0   NM_143268.1  CG6277-RA (CG6277), mRNA 
0   NM_206283.1  CG8398-RD, transcript variant D (CG8398), mRNA 
0   NM_139794.1  CG8398-RA, transcript variant A (CG8398), mRNA 
0   NM_141742.2  CG6312-RA (Rfx), mRNA 
0   NM_143269.2  CG6271-RA (CG6271), mRNA 
0   NM_168174.1  CG8398-RC, transcript variant C (CG8398), mRNA 
0   NM_135051.3  CG31917-RA (CG31917), mRNA 
0   NM_168173.1  CG8398-RB, transcript variant B (CG8398), mRNA 
0   NM_139776.2  CG10289-RA (CG10289), mRNA 
0   NM_136102.2  CG10689-RA (CG10689), mRNA 
0   NM_141376.2  CG15594-RA, transcript variant A (CG15594), mRNA 
0   NM_169132.1  CG15594-RB, transcript variant B (CG15594), mRNA 
0   NM_141496.1  CG3250-RA (Os-C), mRNA 
0   NM_057388.2  CG9224-RA (sog), mRNA 
0   10  NM_001042816.1  CG9907-RC, transcript variant C (para), mRNA 
0   NM_142195.1  CG6194-RA (CG6194), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.