National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4148R-1 
 Symbol wek  Full Name weckle 
 CG No CG4148  Old CG No CG4148 
 Synonyms l(2)35Ea, CG4148, unnamed, BG:DS09217.5, l35Ea, l(2)br47, wek 
 Accession No (Link to NCBI) NM_080191.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGTTTGCGATCACTGCGGAA 
 Primer Seq. 3'
aatctagaggtaccCTTGGCCATCTCGCGAGTTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACGTTTGCGA TCACTGCGGA AAGGGTTTGA AGACCTTCAC ATCGCTGGTG GAGCACCANC 
0061 TGGTTCACAC GGAAGAGAAG CCCTGTATAT GCCCCGTCTG CAATGCTGGT TTTAAGAACA 
0121 AAGCTAGGCT GAGAGTGCAC AGTCAGACAC ATGGTGAGCC CAAGTTTGAG TGCAATgTCT 
0181 GCGGCAAAAA GCTGCAGACA CGGGCGATTC TTAACAAGNA CAAGTATGTG CACACGGATG 
0241 AGCGGCGCTT CAAGTGCGAG GTTTGTGGCA GCGGCTGTAA GGAACTCCAC GGCCTTGAAG 
0301 ATCCATCTCC TTGGACACAC CGGCCTCAGA CCCTACGTAT GCAAGTACTG CGGANAGGCG 
0361 TTCGCCAGCA ACACCAACTG TCGCTCCCAC AAATGGAAAA AACATCCGGA NCTGGCGTCC 
0421 AAGGAGGATG AAACCGAATC TTCACGTGTT CCAGTGCCAA CATTGGAAGA ACTGAGAGCG 
0481 ATAACTCGCG AGATGGCCAA G 
 in silico PCR Fragment
0001 ACGTTTGCGA TCACTGCGGA AAGGGTTTGA AGACCTTCAC ATCGCTGGTG GAGCACCAGC 
0061 TGGTTCACAC GGAAGAGAAG CCCTGTATAT GCCCCGTCTG CAATGCTGGT TTTAAGAACA 
0121 AAGCTAGGCT GAGAGTGCAC AGTCAGACAC ATGGTGAGCC CAAGTTTGAG TGCAATGTCT 
0181 GCGGCAAAAA GCTGCAGACA CGGGCGATTC TTAACAAGCA CAAGTATGTG CACACGGATG 
0241 AGCGGCGCTT CAAGTGCGAG GTTTGTGGCA GCGGCTGTAA -GAACTCCAC GGCCTTGAAG 
0301 ATCCATCTCC TTGGACACAC CGGCCTCAGA CCCTACGTAT GCAAGTACTG CGGAAAGGCG 
0361 TTCGCCAGCA ACACCAACTG TCGCTCCCAC AAATGGAAAA AACATCCGGA ACTGGCGTCC 
0421 AAGGAGGATG AAACCGAATC TTCACGTGTT CCAGTGCCAA CATTGGAAGA ACTGAGAGCG 
0481 ATAACTCGCG AGATGGCCAA G 
 Assemble Data

4148R-1.IR_full       1   ACGTTTGCGATCACTGCGGAAAGGGTTTGAAGACCTTCACATCGCTGGTGGAGCACCANC 60
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
4148R-1.in silico     1   ACGTTTGCGATCACTGCGGAAAGGGTTTGAAGACCTTCACATCGCTGGTGGAGCACCAGC 60


4148R-1.IR_full       61  TGGTTCACACGGAAGAGAAGCCCTGTATATGCCCCGTCTGCAATGCTGGTTTTAAGAACA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4148R-1.in silico     61  TGGTTCACACGGAAGAGAAGCCCTGTATATGCCCCGTCTGCAATGCTGGTTTTAAGAACA 120


4148R-1.IR_full       121 AAGCTAGGCTGAGAGTGCACAGTCAGACACATGGTGAGCCCAAGTTTGAGTGCAATGTCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4148R-1.in silico     121 AAGCTAGGCTGAGAGTGCACAGTCAGACACATGGTGAGCCCAAGTTTGAGTGCAATGTCT 180


4148R-1.IR_full       181 GCGGCAAAAAGCTGCAGACACGGGCGATTCTTAACAAGNACAAGTATGTGCACACGGATG 240
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
4148R-1.in silico     181 GCGGCAAAAAGCTGCAGACACGGGCGATTCTTAACAAGCACAAGTATGTGCACACGGATG 240


4148R-1.IR_full       241 AGCGGCGCTTCAAGTGCGAGGTTTGTGGCAGCGGCTGTAAGGAACTCCACGGCCTTGAAG 300
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
4148R-1.in silico     241 AGCGGCGCTTCAAGTGCGAGGTTTGTGGCAGCGGCTGTAA-GAACTCCACGGCCTTGAAG 300


4148R-1.IR_full       301 ATCCATCTCCTTGGACACACCGGCCTCAGACCCTACGTATGCAAGTACTGCGGANAGGCG 360
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
4148R-1.in silico     301 ATCCATCTCCTTGGACACACCGGCCTCAGACCCTACGTATGCAAGTACTGCGGAAAGGCG 360


4148R-1.IR_full       361 TTCGCCAGCAACACCAACTGTCGCTCCCACAAATGGAAAAAACATCCGGANCTGGCGTCC 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
4148R-1.in silico     361 TTCGCCAGCAACACCAACTGTCGCTCCCACAAATGGAAAAAACATCCGGAACTGGCGTCC 420


4148R-1.IR_full       421 AAGGAGGATGAAACCGAATCTTCACGTGTTCCAGTGCCAACATTGGAAGAACTGAGAGCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4148R-1.in silico     421 AAGGAGGATGAAACCGAATCTTCACGTGTTCCAGTGCCAACATTGGAAGAACTGAGAGCG 480


4148R-1.IR_full       481 ATAACTCGCGAGATGGCCAAG 501
                          |||||||||||||||||||||
4148R-1.in silico     481 ATAACTCGCGAGATGGCCAAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080191.2  CG4148-RA (wek), mRNA 
0   11  NM_176242.1  CG33133-RA (grau), mRNA 
0   NM_142401.2  CG17806-RA (CG17806), mRNA 
0   11  31  NM_136107.2  CG17568-RA (CG17568), mRNA 
0   NM_169331.1  CG6235-RH, transcript variant H (tws), mRNA 
0   NM_169330.1  CG6235-RG, transcript variant G (tws), mRNA 
0   NM_134285.1  CG6235-RC, transcript variant C (tws), mRNA 
0   NM_134284.1  CG6235-RD, transcript variant D (tws), mRNA 
0   NM_057533.2  CG6235-RE, transcript variant E (tws), mRNA 
0   NM_134286.1  CG6235-RB, transcript variant B (tws), mRNA 
0   NM_169329.1  CG6235-RF, transcript variant F (tws), mRNA 
0   NM_057532.3  CG6235-RA, transcript variant A (tws), mRNA 
0   NM_169142.1  CG10272-RB, transcript variant B (gpp), mRNA 
0   NM_141398.1  CG10272-RA, transcript variant A (gpp), mRNA 
0   NM_169143.1  CG10272-RD, transcript variant D (gpp), mRNA 
0   NM_169144.1  CG10272-RC, transcript variant C (gpp), mRNA 
0   NM_136367.1  CG30431-RA (CG30431), mRNA 
0   NM_057897.3  CG14938-RB, transcript variant B (crol), mRNA 
0   NM_057895.3  CG14938-RA, transcript variant A (crol), mRNA 
0   NM_057896.3  CG14938-RC, transcript variant C (crol), mRNA 
0   NM_130577.2  CG3095-RA (hfw), mRNA 
0   NM_135268.2  CG5160-RA (CG5160), mRNA 
0   NM_135324.2  CG7228-RA, transcript variant A (pes), mRNA 
0   NM_164777.1  CG7228-RB, transcript variant B (pes), mRNA 
0   NM_135755.1  CG9932-RA (CG9932), mRNA 
0   NM_057253.3  CG4158-RA (wor), mRNA 
0   11  28  NM_057956.2  CG10269-RA (D19A), mRNA 
0   10  30  NM_167319.3  CG32656-RA (CG32656), mRNA 
0   14  NM_057949.3  CG10270-RA (D19B), mRNA 
0   NM_164966.2  CG6464-RA (salm), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.