National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4144R-3 
 Symbol GNBP2  Full Name Gram-negative bacteria binding protein 2 
 CG No CG4144  Old CG No CG4144 
 Synonyms GNBP, DGNBP-2, CG4144, GNBP2 
 Accession No (Link to NCBI) NM_168771.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGACACCTGCCCGGCTCTAA 
 Primer Seq. 3'
aatctagaggtaccCTCGGTGGCGATAGTGGGAAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACGACACCTG CCCGGCTCTA ATGGACTACA TCACGGAGGC AGTGAACGGA AGTTGGGTCT 
0061 CCAAGCAAAA GATGAGTCTG CAGAACAACG ACAAGCTGCA GATATCAATG CTGGTGCAGT 
0121 TCAATGAGGA AATTTTCGAA AAGAGTGAAA CCAGGGTGAT CATAAACACC CGGCTACTGA 
0181 CCACCAAAGA CTCTAGCTCG CGAGGCATAA CATTCCTTAC AGAAGAGGGC GAGTGCCAGG 
0241 CATACCTAGC TCCTGCACAG CAAGCAAAAC GCTGCAAGGC CGCCCAAACG ATAGTGAGCA 
0301 ATGGACGCCA TACTTGCCAA GGTGAACTGA TCTTTGAGGA CAACTTCTCG GAGGCGCAGC 
0361 TGAACAAGAC CACCTGGAAG CATGACATCC GACAGCGCAT GTACCACGTG GAGGAGGAGC 
0421 TGGTGGCCTT CGACGATGCC GCACGCAACT GCTTTGTGAA GGAAGGCGAA CTCCATATCG 
0481 TTCCCACTAT CGCCACCGAG  
 in silico PCR Fragment
0001 ACGACACCTG CCCGGCTCTA ATGGACTACA TCACGGAGGC AGTGAACGGA AGTTGGGTCT 
0061 CCAAGCAAAA GATGAGTCTG CAGAACAACG ACAAGCTGCA GATATCAATG CTGGTGCAGT 
0121 TCAATGAGGA AATCTTCGAA AAGAGTGAAA CCAGGGTGAT CATAAACACC CGGCTACTGA 
0181 CCACCAAAGA CTCTAGCTCG CGAGGCATAA CATTCCTTAC AGGAGAGGGC GAGTGCCAGG 
0241 CATACCTAGC TCCTGCACAG CAAGCCAAAC GCTGCAAGGC CGCCCAAACG ATAGTGAGCA 
0301 ATGGACGCCA TACTTGCCAG GGTGAACTGA TCTTTGAGGA CAACTTCTCG GAGGCGCAGC 
0361 TGAACAAGAC CACCTGGAAG CATGACATCC GACAGCGCAT GTACCACGTG GAGGAGGAGC 
0421 TGGTGGCCTT CGACGATGCC GCACGCAACT GCTTTGTGAA GGAAGGCGAA CTCCATATCG 
0481 TTCCCACTAT CGCCACCGAG  
 Assemble Data

4144R-3.IR_full       1   ACGACACCTGCCCGGCTCTAATGGACTACATCACGGAGGCAGTGAACGGAAGTTGGGTCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4144R-3.in silico     1   ACGACACCTGCCCGGCTCTAATGGACTACATCACGGAGGCAGTGAACGGAAGTTGGGTCT 60


4144R-3.IR_full       61  CCAAGCAAAAGATGAGTCTGCAGAACAACGACAAGCTGCAGATATCAATGCTGGTGCAGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4144R-3.in silico     61  CCAAGCAAAAGATGAGTCTGCAGAACAACGACAAGCTGCAGATATCAATGCTGGTGCAGT 120


4144R-3.IR_full       121 TCAATGAGGAAATTTTCGAAAAGAGTGAAACCAGGGTGATCATAAACACCCGGCTACTGA 180
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
4144R-3.in silico     121 TCAATGAGGAAATCTTCGAAAAGAGTGAAACCAGGGTGATCATAAACACCCGGCTACTGA 180


4144R-3.IR_full       181 CCACCAAAGACTCTAGCTCGCGAGGCATAACATTCCTTACAGAAGAGGGCGAGTGCCAGG 240
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
4144R-3.in silico     181 CCACCAAAGACTCTAGCTCGCGAGGCATAACATTCCTTACAGGAGAGGGCGAGTGCCAGG 240


4144R-3.IR_full       241 CATACCTAGCTCCTGCACAGCAAGCAAAACGCTGCAAGGCCGCCCAAACGATAGTGAGCA 300
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
4144R-3.in silico     241 CATACCTAGCTCCTGCACAGCAAGCCAAACGCTGCAAGGCCGCCCAAACGATAGTGAGCA 300


4144R-3.IR_full       301 ATGGACGCCATACTTGCCAAGGTGAACTGATCTTTGAGGACAACTTCTCGGAGGCGCAGC 360
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
4144R-3.in silico     301 ATGGACGCCATACTTGCCAGGGTGAACTGATCTTTGAGGACAACTTCTCGGAGGCGCAGC 360


4144R-3.IR_full       361 TGAACAAGACCACCTGGAAGCATGACATCCGACAGCGCATGTACCACGTGGAGGAGGAGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4144R-3.in silico     361 TGAACAAGACCACCTGGAAGCATGACATCCGACAGCGCATGTACCACGTGGAGGAGGAGC 420


4144R-3.IR_full       421 TGGTGGCCTTCGACGATGCCGCACGCAACTGCTTTGTGAAGGAAGGCGAACTCCATATCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4144R-3.in silico     421 TGGTGGCCTTCGACGATGCCGCACGCAACTGCTTTGTGAAGGAAGGCGAACTCCATATCG 480


4144R-3.IR_full       481 TTCCCACTATCGCCACCGAG 500
                          ||||||||||||||||||||
4144R-3.in silico     481 TTCCCACTATCGCCACCGAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168771.1  CG4144-RA, transcript variant A (GNBP2), mRNA 
100   482  NM_168772.1  CG4144-RD, transcript variant D (GNBP2), mRNA 
100   482  NM_079417.2  CG4144-RB, transcript variant B (GNBP2), mRNA 
100   482  NM_168773.1  CG4144-RC, transcript variant C (GNBP2), mRNA 
0.2   NM_057542.2  CG6205-RA (por), mRNA 
0.2   NM_133060.1  CG6179-RA (CG6179), mRNA 
0   NM_168073.1  CG15010-RB, transcript variant B (ago), mRNA 
0   NM_079198.2  CG15010-RC, transcript variant C (ago), mRNA 
0   NM_168072.1  CG15010-RA, transcript variant A (ago), mRNA 
0   NM_132823.1  CG15646-RA (CG15646), mRNA 
0   NM_168826.1  CG8013-RB, transcript variant B (Su(z)12), mRNA 
0   NM_143802.2  CG8013-RA, transcript variant A (Su(z)12), mRNA 
0   NM_166263.1  CG5753-RB, transcript variant B (stau), mRNA 
0   NM_057403.3  CG5753-RA, transcript variant A (stau), mRNA 
0   NM_057915.3  CG9749-RA (Abi), mRNA 
0   NM_130639.2  CG2918-RA (CG2918), mRNA 
0   NM_139805.1  CG10077-RA, transcript variant A (CG10077), mRNA 
0   14  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_206153.1  CG33130-RC, transcript variant C (l(2)k07433), mRNA 
0   NM_176218.1  CG33130-RA, transcript variant A (l(2)k07433), mRNA 
0   NM_206154.1  CG33130-RB, transcript variant B (l(2)k07433), mRNA 
0   NM_166127.1  CG18255-RF, transcript variant F (Strn-Mlck), mRNA 
0   NM_140684.1  CG14060-RA (CG14060), mRNA 
0   NM_165289.1  CG17549-RC, transcript variant C (CG17549), mRNA 
0   NM_165288.1  CG17549-RB, transcript variant B (CG17549), mRNA 
0   NM_136116.4  CG17549-RA, transcript variant A (CG17549), mRNA 
0   NM_133155.2  CG12200-RA (CG12200), mRNA 
0   NM_140971.1  CG5195-RA (CG5195), mRNA 
0   NM_132752.2  CG9517-RA, transcript variant A (CG9517), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.