National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4144R-1 
 Symbol GNBP2  Full Name Gram-negative bacteria binding protein 2 
 CG No CG4144  Old CG No CG4144 
 Synonyms GNBP, DGNBP-2, CG4144, GNBP2 
 Accession No (Link to NCBI) NM_168771.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACGACACCTGCCCGGCTCTAATGGACTACATCACGGAGGCAGTGAACGGAAGTTGGGTCT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCAAGCAAAAGATGAGTCTGCAGAACAACGACAAGCTGCAGATATCAATGCTGGTGCAGT 120

                          ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCAATGAGGAAATCTTCGAAAAGAGTGAAACCAGGGTGATCATAAACACCCGGCTACTGA 180

                          |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     181 CCACCAAAGACTCTAGCTCGCGAGGCATAACATTCCTTACAGGAGAGGGCGAGTGCCAGG 240

                          ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     241 CATACCTAGCTCCTGCACAGCAAGCCAAACGCTGCAAGGCCGCCCAAACGATAGTGAGCA 300

                          ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| silico     301 ATGGACGCCATACTTGCCAGGGTGAACTGATCTTTGAGGACAACTTCTCGGAGGCGCAGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGAACAAGACCACCTGGAAGCATGACATCCGACAGCGCATGTACCACGTGGAGGAGGAGC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGGTGGCCTTCGACGATGCCGCACGCAACTGCTTTGTGAAGGAAGGCGAACTCCATATCG 480

4144R-1.IR_full       481 TTCCCACTATCGCCACCGAG 500
                          |||||||||||||||||||| silico     481 TTCCCACTATCGCCACCGAG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168771.1  CG4144-RA, transcript variant A (GNBP2), mRNA 
100   482  NM_168772.1  CG4144-RD, transcript variant D (GNBP2), mRNA 
100   482  NM_079417.2  CG4144-RB, transcript variant B (GNBP2), mRNA 
100   482  NM_168773.1  CG4144-RC, transcript variant C (GNBP2), mRNA 
0.2   NM_057542.2  CG6205-RA (por), mRNA 
0.2   NM_133060.1  CG6179-RA (CG6179), mRNA 
0   NM_168073.1  CG15010-RB, transcript variant B (ago), mRNA 
0   NM_079198.2  CG15010-RC, transcript variant C (ago), mRNA 
0   NM_168072.1  CG15010-RA, transcript variant A (ago), mRNA 
0   NM_132823.1  CG15646-RA (CG15646), mRNA 
0   NM_168826.1  CG8013-RB, transcript variant B (Su(z)12), mRNA 
0   NM_143802.2  CG8013-RA, transcript variant A (Su(z)12), mRNA 
0   NM_166263.1  CG5753-RB, transcript variant B (stau), mRNA 
0   NM_057403.3  CG5753-RA, transcript variant A (stau), mRNA 
0   NM_057915.3  CG9749-RA (Abi), mRNA 
0   NM_130639.2  CG2918-RA (CG2918), mRNA 
0   NM_139805.1  CG10077-RA, transcript variant A (CG10077), mRNA 
0   14  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_206153.1  CG33130-RC, transcript variant C (l(2)k07433), mRNA 
0   NM_176218.1  CG33130-RA, transcript variant A (l(2)k07433), mRNA 
0   NM_206154.1  CG33130-RB, transcript variant B (l(2)k07433), mRNA 
0   NM_166127.1  CG18255-RF, transcript variant F (Strn-Mlck), mRNA 
0   NM_140684.1  CG14060-RA (CG14060), mRNA 
0   NM_165289.1  CG17549-RC, transcript variant C (CG17549), mRNA 
0   NM_165288.1  CG17549-RB, transcript variant B (CG17549), mRNA 
0   NM_136116.4  CG17549-RA, transcript variant A (CG17549), mRNA 
0   NM_133155.2  CG12200-RA (CG12200), mRNA 
0   NM_140971.1  CG5195-RA (CG5195), mRNA 
0   NM_132752.2  CG9517-RA, transcript variant A (CG9517), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.