National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4120R-1 
 Symbol Cyp12c1  Full Name Cyp12c1 
 CG No CG4120  Old CG No CG4120 
 Synonyms 12c1, CG4120, Cyp12c1 
 Accession No (Link to NCBI) NM_140795.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAATTCCCAGCTGGCTGCCAC 
 Primer Seq. 3'
aatctagaggtaccTCACAAACTGCCGGTTGACGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAATTCCCAG CTGGCTGCCA CCAGAAACCC AGATGCATCA TCGTACGTCC AGCAGCTGGA 
0061 ATCAGAATGG GAGGGCGCCA AACCCTTTAC GGAACTTCCC GGCCCGACAC GCTGGCAATT 
0121 GTTCCGCGGC TTCCAGAAGG GCGGTGAGTA CCACCAACTG GGCATGGATG ATGTGATGCG 
0181 GCTGTACAAA AAGCAGTTCG GCGACATATG CCTGATACCC GGATTATTCG GCATGCCATC 
0241 CACTGTGTTC ACGTTCAATG TGGAAACCTT TGAGAAGGTC TATCGCACCG AAGGTCAGTG 
0301 GCCCGTCCGC GGTGGCGCCG ANACCCGTCA TCCACTACCG CAATAAGCGG AAGGATGAGT 
0361 TTTTCAAGAA CTGCATGGGA TTGTTCGGCA ATGGCGCGGA GTGGGGAAAG AATAGAAGTG 
0421 CCGTGAATCC CGTCCTGATG CAGCACCGAA ATGTTGCAAT CTATCTGAAA CCGATGCAGC 
0481 GCGTCAACCG GcAGTTTGTG A 
 in silico PCR Fragment
0001 CAATTCCCAG CTGGCTGCCA CCAGAAACCC AGATGCATCA TCGTACGTCC AGCAGCTGGA 
0061 ATCAGAATGG GAGGGCGCCA AACCCTTTAC GGAACTTCCC GGCCCGACAC GCTGGCAATT 
0121 GTTCCGCGGC TTCCAGAAGG GCGGTGAGTA CCACCAACTG GGCATGGATG ATGTGATGCG 
0181 GCTGTACAAA AAGCAGTTCG GCGACATATG CTTGATACCC GGATTATTCG GCATGCCATC 
0241 CACTGTGTTC ACGTTCAATG TGGAAACCTT TGAGAAGGTC TATCGCACCG AAGGTCAGTG 
0301 GCCCGTCCGC GGTGGCGCCG A-ACCCGTCA TCCACTACCG CAATAAGCGG AAGGATGAGT 
0361 TTTTCAAGAA CTGCATGGGA TTGTTCGGCA ATGGCGCGGA GTGGGGAAAG AATAGAAGTG 
0421 CCGTGAATCC CGTCCTGATG CAGCACCGAA ATGTTGCAAT CTATCTGAAA CCGATGCAGC 
0481 GCGTCAACCG GCAGTTTGTG A 
 Assemble Data

4120R-1.IR_full       1   CAATTCCCAGCTGGCTGCCACCAGAAACCCAGATGCATCATCGTACGTCCAGCAGCTGGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4120R-1.in silico     1   CAATTCCCAGCTGGCTGCCACCAGAAACCCAGATGCATCATCGTACGTCCAGCAGCTGGA 60


4120R-1.IR_full       61  ATCAGAATGGGAGGGCGCCAAACCCTTTACGGAACTTCCCGGCCCGACACGCTGGCAATT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4120R-1.in silico     61  ATCAGAATGGGAGGGCGCCAAACCCTTTACGGAACTTCCCGGCCCGACACGCTGGCAATT 120


4120R-1.IR_full       121 GTTCCGCGGCTTCCAGAAGGGCGGTGAGTACCACCAACTGGGCATGGATGATGTGATGCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4120R-1.in silico     121 GTTCCGCGGCTTCCAGAAGGGCGGTGAGTACCACCAACTGGGCATGGATGATGTGATGCG 180


4120R-1.IR_full       181 GCTGTACAAAAAGCAGTTCGGCGACATATGCCTGATACCCGGATTATTCGGCATGCCATC 240
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
4120R-1.in silico     181 GCTGTACAAAAAGCAGTTCGGCGACATATGCTTGATACCCGGATTATTCGGCATGCCATC 240


4120R-1.IR_full       241 CACTGTGTTCACGTTCAATGTGGAAACCTTTGAGAAGGTCTATCGCACCGAAGGTCAGTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4120R-1.in silico     241 CACTGTGTTCACGTTCAATGTGGAAACCTTTGAGAAGGTCTATCGCACCGAAGGTCAGTG 300


4120R-1.IR_full       301 GCCCGTCCGCGGTGGCGCCGANACCCGTCATCCACTACCGCAATAAGCGGAAGGATGAGT 360
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
4120R-1.in silico     301 GCCCGTCCGCGGTGGCGCCGA-ACCCGTCATCCACTACCGCAATAAGCGGAAGGATGAGT 360


4120R-1.IR_full       361 TTTTCAAGAACTGCATGGGATTGTTCGGCAATGGCGCGGAGTGGGGAAAGAATAGAAGTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4120R-1.in silico     361 TTTTCAAGAACTGCATGGGATTGTTCGGCAATGGCGCGGAGTGGGGAAAGAATAGAAGTG 420


4120R-1.IR_full       421 CCGTGAATCCCGTCCTGATGCAGCACCGAAATGTTGCAATCTATCTGAAACCGATGCAGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4120R-1.in silico     421 CCGTGAATCCCGTCCTGATGCAGCACCGAAATGTTGCAATCTATCTGAAACCGATGCAGC 480


4120R-1.IR_full       481 GCGTCAACCGGCAGTTTGTGA 501
                          |||||||||||||||||||||
4120R-1.in silico     481 GCGTCAACCGGCAGTTTGTGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140795.2  CG4120-RA (Cyp12c1), mRNA 
0   NM_142525.2  CG11821-RA (Cyp12a5), mRNA 
0   NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_206397.1  CG5992-RB, transcript variant B (Adgf-A), mRNA 
0   NM_079406.2  CG5992-RA, transcript variant A (Adgf-A), mRNA 
0   NM_135678.1  CG14934-RA (CG14934), mRNA 
0   NM_135247.2  CG9138-RA (SP1070), mRNA 
0   NM_143379.2  CG1647-RA (CG1647), mRNA 
0   NM_136972.2  CG12488-RA (CG12488), mRNA 
0   NM_134847.2  CG9883-RA (CG9883), mRNA 
0   NM_001042827.1  CG41482-RA (CG41482), mRNA 
0   NM_136452.2  CG1598-RA (CG1598), mRNA 
0   NM_135725.1  CG5421-RA (CG5421), mRNA 
0   NM_137098.2  CG8485-RA, transcript variant A (CG8485), mRNA 
0   NM_166043.1  CG8485-RD, transcript variant D (CG8485), mRNA 
0   NM_166041.1  CG8485-RB, transcript variant B (CG8485), mRNA 
0   NM_166042.1  CG8485-RC, transcript variant C (CG8485), mRNA 
0   NM_176223.2  CG30115-RD, transcript variant D (CG30115), mRNA 
0   NM_001043070.1  CG34146-RA (brp), mRNA 
0   NM_166874.1  CG3638-RA, transcript variant A (CG3638), mRNA 
0   NM_130541.3  CG3638-RC, transcript variant C (CG3638), mRNA 
0   NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 
0   NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
0   NM_134892.2  CG17264-RA (CG17264), mRNA 
0   NM_141731.1  CG3996-RA (CG3996), mRNA 
0   NM_079613.2  CG7642-RA (ry), mRNA 
0   NM_140686.3  CG3764-RA (CG3764), mRNA 
0   NM_140169.2  CG6321-RA (CG6321), mRNA 
0   14  NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   NM_140466.1  CG5295-RA (CG5295), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.