National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4105R-3 
 Symbol Cyp4e3  Full Name Cytochrome P450-4e3 
 CG No CG4105  Old CG No CG4105 
 Synonyms cyp4e3, 4e3, P450, P-450, CG4105, Cyp4e3 
 Accession No (Link to NCBI) NM_078803.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTCTGCCACTGATCACATTG 
 Primer Seq. 3'
aatctagaggtaccTAGTTGGCATGCTCCTGGAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTTCTGCCAC TGATCACATT GGTGTACTTT GAACGGAAGG CATCGCAACG GCGCCAACTG 
0061 CTCAAGGAAT TCAATGGACC CACTCCGGTG CCCATTTTgG GCAACGCCAA NTCGGATTGG 
0121 CAAAAATCCG GCAGAAATAC TGTCTACATT CTTTGATTGG TGGTACGACT ACGGAAAAGA 
0181 TAACTTTCTC TTCTGGATCG GATACAGTTC TCACATAGTG ATGACCAATC CCAAGCAATT 
0241 GGAGTACATT TTGAACAGTC AGCAACTGAT ACAAAAATCC ACCATCTACG ATCTACTGCA 
0301 TCCATGGCTG GGTCATGGTC TTCTAACGAG TTATGGTAGC AAATGGCATA AACACCGCAA 
0361 GATGATCACC CCATCCTTCC ACTTCAACAT CCTGCAGGAC TTCCACGAGG TGATGAACGA 
0421 GAACTCCGCA AAGTTTATGA CTCAGTTGAA GAAGGCGAGC GCGGGAGACA CTATCATTGA 
0481 TTTCCAGGAG CATGCCAACT A 
 in silico PCR Fragment
0001 GTTCTGCCAC TGATCACATT GGTGTACTTT GAACGGAAGG CATCGCAACG GCGCCAACTG 
0061 CTCAAGGAAT TCAATGGACC CACTCCGGTG CCCATTTTGG GCAACGCCAA -TCGGATTGG 
0121 CAAAAATCCG GCAGAAATAC TGTCTACATT CTTTGATTGG TGGTACGACT ACGGAAAAGA 
0181 TAACTTTCTC TTCTGGATCG GATACAGTTC CCACATTGTG ATGACCAATC CCAAGCAATT 
0241 GGAGTACATT TTGAACAGTC AGCAACTGAT ACAAAAATCC ACCATCTACG ATCTACTGCA 
0301 TCCATGGCTG GGTCATGGTC TTCTAACGAG TTTTGGTAGT AAATGGCATA AACACCGCAA 
0361 GATGATCACC CCATCCTTCC ACTTCAACAT CCTGCAGGAC TTCCACGAGG TGATGAACGA 
0421 GAACTCCGCA AAGTTTATGA CTCAGTTGAA GAAGGCGAGC GCGGGAGACA CTATCATTGA 
0481 TTTCCAGGAG CATGCCAACT A 
 Assemble Data

4105R-3.IR_full       1   GTTCTGCCACTGATCACATTGGTGTACTTTGAACGGAAGGCATCGCAACGGCGCCAACTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4105R-3.in silico     1   GTTCTGCCACTGATCACATTGGTGTACTTTGAACGGAAGGCATCGCAACGGCGCCAACTG 60


4105R-3.IR_full       61  CTCAAGGAATTCAATGGACCCACTCCGGTGCCCATTTTGGGCAACGCCAANTCGGATTGG 120
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
4105R-3.in silico     61  CTCAAGGAATTCAATGGACCCACTCCGGTGCCCATTTTGGGCAACGCCAA-TCGGATTGG 120


4105R-3.IR_full       121 CAAAAATCCGGCAGAAATACTGTCTACATTCTTTGATTGGTGGTACGACTACGGAAAAGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4105R-3.in silico     121 CAAAAATCCGGCAGAAATACTGTCTACATTCTTTGATTGGTGGTACGACTACGGAAAAGA 180


4105R-3.IR_full       181 TAACTTTCTCTTCTGGATCGGATACAGTTCTCACATAGTGATGACCAATCCCAAGCAATT 240
                          |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||
4105R-3.in silico     181 TAACTTTCTCTTCTGGATCGGATACAGTTCCCACATTGTGATGACCAATCCCAAGCAATT 240


4105R-3.IR_full       241 GGAGTACATTTTGAACAGTCAGCAACTGATACAAAAATCCACCATCTACGATCTACTGCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4105R-3.in silico     241 GGAGTACATTTTGAACAGTCAGCAACTGATACAAAAATCCACCATCTACGATCTACTGCA 300


4105R-3.IR_full       301 TCCATGGCTGGGTCATGGTCTTCTAACGAGTTATGGTAGCAAATGGCATAAACACCGCAA 360
                          |||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||
4105R-3.in silico     301 TCCATGGCTGGGTCATGGTCTTCTAACGAGTTTTGGTAGTAAATGGCATAAACACCGCAA 360


4105R-3.IR_full       361 GATGATCACCCCATCCTTCCACTTCAACATCCTGCAGGACTTCCACGAGGTGATGAACGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4105R-3.in silico     361 GATGATCACCCCATCCTTCCACTTCAACATCCTGCAGGACTTCCACGAGGTGATGAACGA 420


4105R-3.IR_full       421 GAACTCCGCAAAGTTTATGACTCAGTTGAAGAAGGCGAGCGCGGGAGACACTATCATTGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4105R-3.in silico     421 GAACTCCGCAAAGTTTATGACTCAGTTGAAGAAGGCGAGCGCGGGAGACACTATCATTGA 480


4105R-3.IR_full       481 TTTCCAGGAGCATGCCAACTA 501
                          |||||||||||||||||||||
4105R-3.in silico     481 TTTCCAGGAGCATGCCAACTA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078803.1  CG4105-RA (Cyp4e3), mRNA 
9.95   48  35  11  NM_057769.3  CG2060-RA (Cyp4e2), mRNA 
2.07   10  22  43  18  NM_080032.2  CG2062-RA (Cyp4e1), mRNA 
0.2   NM_170499.2  CG9720-RA (PH4alphaNE2), mRNA 
0   NM_140086.1  CG16717-RA (CG16717), mRNA 
0   NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   NM_206109.1  CG8118-RC, transcript variant C (mam), mRNA 
0   NM_078681.2  CG32540-RA (CCKLR-17D3), mRNA 
0   NM_137054.1  CG6280-RA (CG6280), mRNA 
0   NM_136422.2  CG1845-RA (CG1845), mRNA 
0   NM_176350.1  CG14085-RB, transcript variant B (CG14085), mRNA 
0   NM_140844.1  CG14085-RA, transcript variant A (CG14085), mRNA 
0   NM_001043253.1  CG14885-RC, transcript variant C (Gyc-89Da), mRNA 
0   NM_001043254.1  CG14885-RB, transcript variant B (Gyc-89Da), mRNA 
0   NM_138041.2  CG4049-RA (CG4049), mRNA 
0   10  NM_167193.1  CG32702-RA (CG32702), mRNA 
0   NM_169794.1  CG7187-RB, transcript variant B (Ssdp), mRNA 
0   NM_169795.1  CG7187-RC, transcript variant C (Ssdp), mRNA 
0   NM_142431.1  CG7187-RA, transcript variant A (Ssdp), mRNA 
0   NM_078569.2  CG1554-RA (RpII215), mRNA 
0   10  NM_057559.3  CG3656-RA, transcript variant A (Cyp4d1), mRNA 
0   NM_142188.2  CG6276-RA (CG6276), mRNA 
0   NM_132328.1  CG17446-RA (CG17446), mRNA 
0   NM_206404.1  CG33287-RA (CG33287), mRNA 
0   NM_078779.2  CG5125-RB, transcript variant B (ninaC), mRNA 
0   NM_164747.1  CG5125-RA, transcript variant A (ninaC), mRNA 
0   NM_138105.1  CG13594-RA (CG13594), mRNA 
0   NM_143032.1  CG6980-RA (CG6980), mRNA 
0   NM_169052.1  CG2666-RB, transcript variant B (kkv), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
+- 
DB
++ 
DC
++ 
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.