National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4065R-1 
 Symbol CG4065  Full Name CG4065 
 CG No CG4065  Old CG No CG4065 
 Synonyms anon-EST:Nelson1, CG4065 
 Accession No (Link to NCBI) NM_138047.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCACCATGAACGGAAGCAGC 
 Primer Seq. 3'
aatctagaggtaccACCTGGTCCATGGAGTTGCCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCACCATGA ACGGAAGCAG CGTTGCAGAG cCTCCGGACT TCCAGGCTGC CACGGCGGCC 
0061 GCGGCGGCAG CTGCCCGGGC CAGTAGCTTG GAACAGGACG AGTGGAGCGT GGGCGAGTGC 
0121 GGATTTCTGG ATCCGGATGT GCAGCGCACC ATGCGGAGCG GCAGTGCTGC GGAGGACATC 
0181 ACCCAGTACC CGATGCACGG CTGGGTGGAC GTAACCAAGG AGTTCCACGA TGCCTGCGCG 
0241 GAGCTGCAGC CCGGGGAACT GGCCCAGGAT ATGCTGTTCG GTCTTTTTGA GGCCATGTCA 
0301 GCCATCGAGA TCATGGACCC CAAGATGGAC GTGGGCATGG GCTTCGACAA GCAGGATCTT 
0361 CCGCCGCCCT CTTTCGAGGC AGCCATTGCC ACGGGCGCCA TCAAACTGGA CGATCTCACG 
0421 CCCTCCGAAC TGATTGGCAT CTATGATGCT CTGTTTTCCT GCCTGGTGTC CTGGCTGGAG 
0481 GGCAACTCCA TGGACCAGGT  
 in silico PCR Fragment
0001 AGCACCATGA ACGGAAGCAG CGTTGCAGAG CCTCCGGACT TCCAGGCTGC CACGGCGGCC 
0061 GCGGCGGCAG CTGCCCGGGC CAGTAGCTTG GAACAGGACG AGTGGAGCGT GGGCGAGTGC 
0121 GGATTTCTGG ATCCGGATGT GCAGCGCACC ATGCGGAGCG GCAGTGCTGC GGAGGACATC 
0181 ACCCAGTACC CGATGCACGG CTGGGTGGAC GTAACCAAGG AGTTCCACGA TGCCTGCGCG 
0241 GAGCTGCAGC CCGGGGAACT GGCCCAGGAT ATGCTGTTCG GTCTTTTTGA GGCCATGTCA 
0301 GCCATCGAGA TCATGGACCC CAAGATGGAC GTGGGCATGG GCTTCGACAA GCAGGATCTT 
0361 CCGCCGCCCT CTTTCGAGGC AGCCATTGCC ACGGGCGCCA TCAAACTGGA CGATCTCACG 
0421 CCCTCCGAAC TGATTGGCAT CTATGATGCT CTGTTTTCCT GCCTGGTGTC CTGGCTGGAG 
0481 GGCAACTCCA TGGACCAGGT  
 Assemble Data

4065R-1.IR_full       1   AGCACCATGAACGGAAGCAGCGTTGCAGAGCCTCCGGACTTCCAGGCTGCCACGGCGGCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4065R-1.in silico     1   AGCACCATGAACGGAAGCAGCGTTGCAGAGCCTCCGGACTTCCAGGCTGCCACGGCGGCC 60


4065R-1.IR_full       61  GCGGCGGCAGCTGCCCGGGCCAGTAGCTTGGAACAGGACGAGTGGAGCGTGGGCGAGTGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4065R-1.in silico     61  GCGGCGGCAGCTGCCCGGGCCAGTAGCTTGGAACAGGACGAGTGGAGCGTGGGCGAGTGC 120


4065R-1.IR_full       121 GGATTTCTGGATCCGGATGTGCAGCGCACCATGCGGAGCGGCAGTGCTGCGGAGGACATC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4065R-1.in silico     121 GGATTTCTGGATCCGGATGTGCAGCGCACCATGCGGAGCGGCAGTGCTGCGGAGGACATC 180


4065R-1.IR_full       181 ACCCAGTACCCGATGCACGGCTGGGTGGACGTAACCAAGGAGTTCCACGATGCCTGCGCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4065R-1.in silico     181 ACCCAGTACCCGATGCACGGCTGGGTGGACGTAACCAAGGAGTTCCACGATGCCTGCGCG 240


4065R-1.IR_full       241 GAGCTGCAGCCCGGGGAACTGGCCCAGGATATGCTGTTCGGTCTTTTTGAGGCCATGTCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4065R-1.in silico     241 GAGCTGCAGCCCGGGGAACTGGCCCAGGATATGCTGTTCGGTCTTTTTGAGGCCATGTCA 300


4065R-1.IR_full       301 GCCATCGAGATCATGGACCCCAAGATGGACGTGGGCATGGGCTTCGACAAGCAGGATCTT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4065R-1.in silico     301 GCCATCGAGATCATGGACCCCAAGATGGACGTGGGCATGGGCTTCGACAAGCAGGATCTT 360


4065R-1.IR_full       361 CCGCCGCCCTCTTTCGAGGCAGCCATTGCCACGGGCGCCATCAAACTGGACGATCTCACG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4065R-1.in silico     361 CCGCCGCCCTCTTTCGAGGCAGCCATTGCCACGGGCGCCATCAAACTGGACGATCTCACG 420


4065R-1.IR_full       421 CCCTCCGAACTGATTGGCATCTATGATGCTCTGTTTTCCTGCCTGGTGTCCTGGCTGGAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4065R-1.in silico     421 CCCTCCGAACTGATTGGCATCTATGATGCTCTGTTTTCCTGCCTGGTGTCCTGGCTGGAG 480


4065R-1.IR_full       481 GGCAACTCCATGGACCAGGT 500
                          ||||||||||||||||||||
4065R-1.in silico     481 GGCAACTCCATGGACCAGGT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138047.2  CG4065-RA, transcript variant A (CG4065), mRNA 
96.26   464  NM_001014546.1  CG4065-RB, transcript variant B (CG4065), mRNA 
0.41   20  NM_057896.3  CG14938-RC, transcript variant C (crol), mRNA 
0.41   20  NM_057895.3  CG14938-RA, transcript variant A (crol), mRNA 
0.41   20  NM_057897.3  CG14938-RB, transcript variant B (crol), mRNA 
0.41   20  NM_164971.1  CG14938-RD, transcript variant D (crol), mRNA 
0.2   NM_132115.1  CG14440-RA (CG14440), mRNA 
0   NM_141809.1  CG6715-RA (KP78a), mRNA 
0   NM_078496.2  CG3025-RA (mof), mRNA 
0   24  NM_167387.1  CG32611-RB (CG32611), mRNA 
0   NM_133014.2  CG6269-RA (unc-4), mRNA 
0   13  22  NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0   13  22  NM_001031887.1  CG33691-RC, transcript variant C (CG33691), mRNA 
0   13  22  NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0   23  NM_001031888.1  CG33691-RB, transcript variant B (CG33691), mRNA 
0   23  NM_001031885.1  CG33692-RB, transcript variant B (CG33692), mRNA 
0   15  NM_001031884.1  CG33692-RC, transcript variant C (CG33692), mRNA 
0   12  NM_079155.2  CG9102-RA (bab2), mRNA 
0   NM_078842.4  CG4220-RA, transcript variant A (elB), mRNA 
0   NM_205990.1  CG4220-RC, transcript variant C (elB), mRNA 
0   NM_176045.1  CG4220-RB, transcript variant B (elB), mRNA 
0   NM_168071.1  CG14997-RB, transcript variant B (CG14997), mRNA 
0   NM_139620.1  CG14997-RA, transcript variant A (CG14997), mRNA 
0   NM_130655.1  CG8636-RA (CG8636), mRNA 
0   NM_134674.1  CG11911-RA (CG11911), mRNA 
0   NM_079307.1  CG7260-RA (byn), mRNA 
0   NM_141578.1  CG8351-RA (CG8351), mRNA 
0   NM_080325.3  CG6450-RC (lva), mRNA 
0   NM_176509.1  CG31247-RA, transcript variant A (tinc), mRNA 
0   NM_176510.1  CG31247-RD, transcript variant D (tinc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.