National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4057R-3 
 Symbol tamo  Full Name tamo 
 CG No CG4057  Old CG No CG4057 
 Synonyms CG4057, 60B, tamo 
 Accession No (Link to NCBI) NM_166664.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATCCCCGATCTGTGGGATGAGATTCTCCGGCGCCACTGGATGTTTCTCGAGACGGAGGAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGCATAGAGAAGCTCGAGGAACGCAAGCAGCTGGAGGGCTGCCTGAAGGAGTTCCTCTGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GTGGTGCAGCACGATCGCAAGTTCTTTCTGCCGGAAACTGGGCATGTCCTGCGGAGGTCT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTGCTCGAGCTGCCCGACTTTTCGGCCCAGAACGCCATCGTAGCCTTCGAGACCATCAGC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAGTATGCCAACAATCTGTTTACGAAGCCATGGCGAAAGGAGTATCGAACTCTCAAGACC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TATTCGGGATGCTTTCAGCACGACATCCAATCCCGCCTGCTGGACGCCGAACAGCTCTTC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTGGCCATGGGCTATCGCCGGGCTGCCGAGGACACCTTCGTCCTCGAGGGTCCCATCTGT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCGGATCAGGTTACGAATGTTTCGCGCGACGCAATGGCCGCCTACGTGGAGTGCCAGATT 480

4057R-3.IR_full       481 ATGAAGCACATCTACGCGGG 500
                          |||||||||||||||||||| silico     481 ATGAAGCACATCTACGCGGG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166664.1  CG4057-RA, transcript variant A (tamo), mRNA 
100   482  NM_138045.2  CG4057-RB, transcript variant B (tamo), mRNA 
0   NM_167398.1  CG32599-RA (CG32599), mRNA 
0   12  NM_135602.2  CG6743-RA (Nup170), mRNA 
0   NM_139732.2  CG10542-RA (CG10542), mRNA 
0   NM_142921.2  CG10225-RA (CG10225), mRNA 
0   NM_167193.1  CG32702-RA (CG32702), mRNA 
0   NM_136936.3  CG8520-RA (CG8520), mRNA 
0   NM_001043115.1  CG1066-RC, transcript variant C (Shab), mRNA 
0   NM_079170.2  CG1066-RB, transcript variant B (Shab), mRNA 
0   NM_167967.1  CG1066-RA, transcript variant A (Shab), mRNA 
0   NM_168546.1  CG10732-RA, transcript variant A (CG10732), mRNA 
0   NM_140393.2  CG10732-RB, transcript variant B (CG10732), mRNA 
0   NM_176385.1  CG33214-RA (CG33214), mRNA 
0   NM_080111.2  CG2684-RA (lds), mRNA 
0   NM_144048.1  CG18678-RA (CG18678), mRNA 
0   NM_135100.2  CG7251-RA (CG7251), mRNA 
0   NM_079442.2  CG8522-RC, transcript variant C (HLH106), mRNA 
0   NM_168815.1  CG8522-RA, transcript variant A (HLH106), mRNA 
0   NM_168816.1  CG8522-RB, transcript variant B (HLH106), mRNA 
0   NM_143179.1  CG5890-RA (CG5890), mRNA 
0   NM_168715.1  CG7930-RB, transcript variant B (TpnC73F), mRNA 
0   NM_057620.4  CG9073-RA (TpnC47D), mRNA 
0   NM_079398.2  CG7930-RA, transcript variant A (TpnC73F), mRNA 
0   NM_166625.1  CG4797-RB, transcript variant B (CG4797), mRNA 
0   NM_137990.2  CG4797-RA, transcript variant A (CG4797), mRNA 
0   NM_169769.1  CG18212-RD, transcript variant D (CG18212), mRNA 
0   NM_169768.1  CG18212-RA, transcript variant A (CG18212), mRNA 
0   NM_142388.2  CG18212-RG, transcript variant G (CG18212), mRNA 
0   NM_206505.1  CG18212-RB, transcript variant B (CG18212), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.