National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4057R-2 
 Symbol tamo  Full Name tamo 
 CG No CG4057  Old CG No CG4057 
 Synonyms CG4057, 60B, tamo 
 Accession No (Link to NCBI) NM_166664.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCCCCGATCTGTGGGATGAG 
 Primer Seq. 3'
aatctagaggtaccCCCGCGTAGATGTGCTTCATA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATCCCCGATC TGTGGGATGA GATTCTCCGG CGCCACTGGA TGTTTCTCGA GACGGAGGAG 
0061 AGCATAGAGA AGCTCGAGGA ACGCAAGCAG CTGGAGGGCT GCCTGAAGGA GTTCCTCTGC 
0121 GTGGTGCAGC ACGATCGCAA GTTCTTTCTG CCGGAAACTG GGCATGTCCT GCGGAGGTCT 
0181 GTGCTCGAGC TGCCCGACTT TTCGGCCCAG AACGCCATCG TAGCCTTCGA GACCATCAGC 
0241 CAGTATGCCA ACAATCTGTT TACGAAGCCA TGGCGAAAGG AGTATCGAAC TCTCAAGACC 
0301 TATTCGGGAT GCTTTCAGCA CGACATCCAA TCCCGCCTGC TGGACGCCGA ACAGCTCTTC 
0361 CTGGCCATgG GCTATCGCCG GGCTGCCGAG GACACCTTCG TCCTCGAGGG TCCCATCTGT 
0421 CCGGATCAGG TTACGAATGT TTCGCGCGAC GCAATGGCCG CCTACGTGGA GTGCCAGATT 
0481 ATGAAGCACA TCTACGCGGG  
 in silico PCR Fragment
0001 ATCCCCGATC TGTGGGATGA GATTCTCCGG CGCCACTGGA TGTTTCTCGA GACGGAGGAG 
0061 AGCATAGAGA AGCTCGAGGA ACGCAAGCAG CTGGAGGGCT GCCTGAAGGA GTTCCTCTGC 
0121 GTGGTGCAGC ACGATCGCAA GTTCTTTCTG CCGGAAACTG GGCATGTCCT GCGGAGGTCT 
0181 GTGCTCGAGC TGCCCGACTT TTCGGCCCAG AACGCCATCG TAGCCTTCGA GACCATCAGC 
0241 CAGTATGCCA ACAATCTGTT TACGAAGCCA TGGCGAAAGG AGTATCGAAC TCTCAAGACC 
0301 TATTCGGGAT GCTTTCAGCA CGACATCCAA TCCCGCCTGC TGGACGCCGA ACAGCTCTTC 
0361 CTGGCCATGG GCTATCGCCG GGCTGCCGAG GACACCTTCG TCCTCGAGGG TCCCATCTGT 
0421 CCGGATCAGG TTACGAATGT TTCGCGCGAC GCAATGGCCG CCTACGTGGA GTGCCAGATT 
0481 ATGAAGCACA TCTACGCGGG  
 Assemble Data

4057R-2.IR_full       1   ATCCCCGATCTGTGGGATGAGATTCTCCGGCGCCACTGGATGTTTCTCGAGACGGAGGAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4057R-2.in silico     1   ATCCCCGATCTGTGGGATGAGATTCTCCGGCGCCACTGGATGTTTCTCGAGACGGAGGAG 60


4057R-2.IR_full       61  AGCATAGAGAAGCTCGAGGAACGCAAGCAGCTGGAGGGCTGCCTGAAGGAGTTCCTCTGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4057R-2.in silico     61  AGCATAGAGAAGCTCGAGGAACGCAAGCAGCTGGAGGGCTGCCTGAAGGAGTTCCTCTGC 120


4057R-2.IR_full       121 GTGGTGCAGCACGATCGCAAGTTCTTTCTGCCGGAAACTGGGCATGTCCTGCGGAGGTCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4057R-2.in silico     121 GTGGTGCAGCACGATCGCAAGTTCTTTCTGCCGGAAACTGGGCATGTCCTGCGGAGGTCT 180


4057R-2.IR_full       181 GTGCTCGAGCTGCCCGACTTTTCGGCCCAGAACGCCATCGTAGCCTTCGAGACCATCAGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4057R-2.in silico     181 GTGCTCGAGCTGCCCGACTTTTCGGCCCAGAACGCCATCGTAGCCTTCGAGACCATCAGC 240


4057R-2.IR_full       241 CAGTATGCCAACAATCTGTTTACGAAGCCATGGCGAAAGGAGTATCGAACTCTCAAGACC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4057R-2.in silico     241 CAGTATGCCAACAATCTGTTTACGAAGCCATGGCGAAAGGAGTATCGAACTCTCAAGACC 300


4057R-2.IR_full       301 TATTCGGGATGCTTTCAGCACGACATCCAATCCCGCCTGCTGGACGCCGAACAGCTCTTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4057R-2.in silico     301 TATTCGGGATGCTTTCAGCACGACATCCAATCCCGCCTGCTGGACGCCGAACAGCTCTTC 360


4057R-2.IR_full       361 CTGGCCATGGGCTATCGCCGGGCTGCCGAGGACACCTTCGTCCTCGAGGGTCCCATCTGT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4057R-2.in silico     361 CTGGCCATGGGCTATCGCCGGGCTGCCGAGGACACCTTCGTCCTCGAGGGTCCCATCTGT 420


4057R-2.IR_full       421 CCGGATCAGGTTACGAATGTTTCGCGCGACGCAATGGCCGCCTACGTGGAGTGCCAGATT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4057R-2.in silico     421 CCGGATCAGGTTACGAATGTTTCGCGCGACGCAATGGCCGCCTACGTGGAGTGCCAGATT 480


4057R-2.IR_full       481 ATGAAGCACATCTACGCGGG 500
                          ||||||||||||||||||||
4057R-2.in silico     481 ATGAAGCACATCTACGCGGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166664.1  CG4057-RA, transcript variant A (tamo), mRNA 
100   482  NM_138045.2  CG4057-RB, transcript variant B (tamo), mRNA 
0   NM_167398.1  CG32599-RA (CG32599), mRNA 
0   12  NM_135602.2  CG6743-RA (Nup170), mRNA 
0   NM_139732.2  CG10542-RA (CG10542), mRNA 
0   NM_142921.2  CG10225-RA (CG10225), mRNA 
0   NM_167193.1  CG32702-RA (CG32702), mRNA 
0   NM_136936.3  CG8520-RA (CG8520), mRNA 
0   NM_001043115.1  CG1066-RC, transcript variant C (Shab), mRNA 
0   NM_079170.2  CG1066-RB, transcript variant B (Shab), mRNA 
0   NM_167967.1  CG1066-RA, transcript variant A (Shab), mRNA 
0   NM_168546.1  CG10732-RA, transcript variant A (CG10732), mRNA 
0   NM_140393.2  CG10732-RB, transcript variant B (CG10732), mRNA 
0   NM_176385.1  CG33214-RA (CG33214), mRNA 
0   NM_080111.2  CG2684-RA (lds), mRNA 
0   NM_144048.1  CG18678-RA (CG18678), mRNA 
0   NM_135100.2  CG7251-RA (CG7251), mRNA 
0   NM_079442.2  CG8522-RC, transcript variant C (HLH106), mRNA 
0   NM_168815.1  CG8522-RA, transcript variant A (HLH106), mRNA 
0   NM_168816.1  CG8522-RB, transcript variant B (HLH106), mRNA 
0   NM_143179.1  CG5890-RA (CG5890), mRNA 
0   NM_168715.1  CG7930-RB, transcript variant B (TpnC73F), mRNA 
0   NM_057620.4  CG9073-RA (TpnC47D), mRNA 
0   NM_079398.2  CG7930-RA, transcript variant A (TpnC73F), mRNA 
0   NM_166625.1  CG4797-RB, transcript variant B (CG4797), mRNA 
0   NM_137990.2  CG4797-RA, transcript variant A (CG4797), mRNA 
0   NM_169769.1  CG18212-RD, transcript variant D (CG18212), mRNA 
0   NM_169768.1  CG18212-RA, transcript variant A (CG18212), mRNA 
0   NM_142388.2  CG18212-RG, transcript variant G (CG18212), mRNA 
0   NM_206505.1  CG18212-RB, transcript variant B (CG18212), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.