National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4012R-1 
 Symbol gek  Full Name genghis khan 
 CG No CG4012  Old CG No CG4012 
 Synonyms MRCKalpha, CG4012, dMRCK, l(2)09373, Gek, anon-WO0200864.1, Mrck, MdaPk, gek 
 Accession No (Link to NCBI) NM_079113.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGGAGCGGGATGTGTTGGTT 
 Primer Seq. 3'
aatctagaggtaccTCTGCGTAGAAGGGCGTCTCT 
 Predicted Fragment Size
485 
 IR fragment full Seq
0001 GAGGAGCGGT GATGTGTTGG TTTTCGGCGA CCGGCAGTGG ATCACCAACC TTCACTATGC 
0061 CTTTCAAGAC AATATTAACC TGTATCTGGT GATGGACTAT TACTGCGGCG GAGACCTGCT 
0121 TACATTGCTC AGCAAATTCG AGGACAAGCT GCCCGAGGAC ATGGCCAAGT TCTACATCAC 
0181 AGAGATGATC CTGGCAATCA ATAGTATTCA CCAGATTAGG TACGTTCACA GGGACATCAA 
0241 GCCGGATAAT GTACTGCTCG ATAAGCGCGG TCACGTGCGC CTGGCTGACT TTGGATCCTG 
0301 CCTGCGCCTG GACAAGGATG GCACCGTACA GTCCAACGTG GCCGTGGGCA CACCCGACTA 
0361 CATTTCCCCG GAAATTTTGA GGGCCATGGA GGACGGAAAG GGACGCTACG GCACGGAGTG 
0421 TGAATTGGTG GTCACTCGGA GTGTGCATGT ACGAGATGCT CTACGGAGAG ACGCCCTTCT 
0481 ACGCAGA 
 in silico PCR Fragment
0001 GAGGAGCGG- GATGTGTTGG TTTTCGGCGA CCGGCAGTGG ATCACCAACC TTCACTATGC 
0061 CTTTCAAGAC AATATTAACC TGTATCTGGT GATGGACTAT TACTGCGGCG GAGACCTGCT 
0121 TACATTGCTC AGCAAATTCG AGGACAAGCT GCCCGAGGAC ATGGCCAAGT TCTACATCAC 
0181 AGAGATGATC CTGGCAATCA ATAGTATTCA CCAGATTAGG TACGTTCACA GGGACATCAA 
0241 GCCGGATAAT GTACTGCTCG ATAAGCGCGG TCACGTGCGC CTGGCTGACT TTGGATCCTG 
0301 CCTGCGCCTG GACAAGGATG GCACCGTACA GTCCAACGTG GCCGTGGGCA CACCCGACTA 
0361 CATTTCCCCG GAAATTTTGA GGGCCATGGA GGACGGAAAG GGACGCTACG GCACGGAGTG 
0421 TG-ATTGGTG GTCACTCGGA GTGTGCATGT ACGAGATGCT CTACGGAGAG ACGCCCTTCT 
0481 ACGCAGA 
 Assemble Data

4012R-1.IR_full       1   GAGGAGCGGTGATGTGTTGGTTTTCGGCGACCGGCAGTGGATCACCAACCTTCACTATGC 60
                          ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
4012R-1.in silico     1   GAGGAGCGG-GATGTGTTGGTTTTCGGCGACCGGCAGTGGATCACCAACCTTCACTATGC 60


4012R-1.IR_full       61  CTTTCAAGACAATATTAACCTGTATCTGGTGATGGACTATTACTGCGGCGGAGACCTGCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4012R-1.in silico     61  CTTTCAAGACAATATTAACCTGTATCTGGTGATGGACTATTACTGCGGCGGAGACCTGCT 120


4012R-1.IR_full       121 TACATTGCTCAGCAAATTCGAGGACAAGCTGCCCGAGGACATGGCCAAGTTCTACATCAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4012R-1.in silico     121 TACATTGCTCAGCAAATTCGAGGACAAGCTGCCCGAGGACATGGCCAAGTTCTACATCAC 180


4012R-1.IR_full       181 AGAGATGATCCTGGCAATCAATAGTATTCACCAGATTAGGTACGTTCACAGGGACATCAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4012R-1.in silico     181 AGAGATGATCCTGGCAATCAATAGTATTCACCAGATTAGGTACGTTCACAGGGACATCAA 240


4012R-1.IR_full       241 GCCGGATAATGTACTGCTCGATAAGCGCGGTCACGTGCGCCTGGCTGACTTTGGATCCTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4012R-1.in silico     241 GCCGGATAATGTACTGCTCGATAAGCGCGGTCACGTGCGCCTGGCTGACTTTGGATCCTG 300


4012R-1.IR_full       301 CCTGCGCCTGGACAAGGATGGCACCGTACAGTCCAACGTGGCCGTGGGCACACCCGACTA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4012R-1.in silico     301 CCTGCGCCTGGACAAGGATGGCACCGTACAGTCCAACGTGGCCGTGGGCACACCCGACTA 360


4012R-1.IR_full       361 CATTTCCCCGGAAATTTTGAGGGCCATGGAGGACGGAAAGGGACGCTACGGCACGGAGTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4012R-1.in silico     361 CATTTCCCCGGAAATTTTGAGGGCCATGGAGGACGGAAAGGGACGCTACGGCACGGAGTG 420


4012R-1.IR_full       421 TGAATTGGTGGTCACTCGGAGTGTGCATGTACGAGATGCTCTACGGAGAGACGCCCTTCT 480
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4012R-1.in silico     421 TG-ATTGGTGGTCACTCGGAGTGTGCATGTACGAGATGCTCTACGGAGAGACGCCCTTCT 480


4012R-1.IR_full       481 ACGCAGA 487
                          |||||||
4012R-1.in silico     481 ACGCAGA 487

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   467  NM_079113.2  CG4012-RA (gek), mRNA 
0.42   NM_057401.3  CG3068-RA (aur), mRNA 
0.42   NM_176397.2  CG32944-RB, transcript variant B (CG32944), mRNA 
0.42   NM_001043201.1  CG32944-RC, transcript variant C (CG32944), mRNA 
0.21   NM_170547.2  CG31003-RA (gskt), mRNA 
0.21   NM_130544.3  CG14622-RA, transcript variant A (DAAM), mRNA 
0.21   NM_166875.1  CG14622-RC, transcript variant C (DAAM), mRNA 
0.21   NM_166876.1  CG14622-RB, transcript variant B (DAAM), mRNA 
0   NM_080016.2  CG4481-RA (Glu-RIB), mRNA 
0   NM_141279.2  CG12147-RA (CG12147), mRNA 
0   NM_142819.1  CG6954-RA (CG6954), mRNA 
0   NM_142893.1  CG10177-RA (CG10177), mRNA 
0   NM_080046.2  CG10986-RB (g), mRNA 
0   NM_167013.1  CG3000-RB, transcript variant B (rap), mRNA 
0   NM_080113.2  CG3000-RA, transcript variant A (rap), mRNA 
0   NM_132566.1  CG2577-RA (CG2577), mRNA 
0   10  NM_170524.1  CG12072-RA (wts), mRNA 
0   NM_057225.3  CG10653-RA (hk), mRNA 
0   12  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_079863.2  CG2048-RC, transcript variant C (dco), mRNA 
0   NM_170535.1  CG2048-RA, transcript variant A (dco), mRNA 
0   NM_078585.3  CG2028-RB, transcript variant B (CkIalpha), mRNA 
0   NM_167332.1  CG2028-RC, transcript variant C (CkIalpha), mRNA 
0   NM_167331.1  CG2028-RA, transcript variant A (CkIalpha), mRNA 
0   NM_170536.2  CG2048-RB, transcript variant B (dco), mRNA 
0   NM_080076.2  CG11770-RA (lin), mRNA 
0   NM_078856.2  CG4838-RA (beat-Ic), mRNA 
0   NM_079304.2  CG11621-RA, transcript variant A (Pi3K68D), mRNA 
0   NM_168475.1  CG11621-RC, transcript variant C (Pi3K68D), mRNA 
0   NM_139680.1  CG17150-RA, transcript variant A (CG17150), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
++ 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.