National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 4007R-3 
 Symbol Nrk  Full Name Neurospecific receptor kinase 
 CG No CG4007  Old CG No CG4007 
 Synonyms CG4007, DmHD-434, Dnrk, nrtk_dros, DNRK, l(2)k14301, HD-434, anon-WO2004063362.79, Nrk 
 Accession No (Link to NCBI) NM_057907.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees male semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Bou Sleiman MS, Osman D, Massouras A, Hoffmann AA, Lemaitre B, Deplancke B.
Genetic, molecular and physiological basis of variation in Drosophila gut immunocompetence.
Nat Commun (2015) 6 7829 [ PubMed ID = 26213329 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCCGGGGAATGGTGCTGAAA 
 Primer Seq. 3'
aatctagaggtaccCCGCGGCTCTTGATGAACATA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTcCGGGGAA TGGTGCTGAA ATGGGGGGCC AATTTGGCTG TCCTGGGGCT GTGCGTGTTT 
0061 CTCTTTGCCA AGCGCCACGC ACGCGAACTC CCTGAACGCC ATCGAGGAGC CCGTCACCCG 
0121 GCGACACCAC CAGCGGCATC ACGAGCGCGA GCGGGAGGAG AACGGCTACT GCGCCTCCGT 
0181 ACAGCGGCAA GGTGTGCAAG GAATACCTCA CCGGCCAGGT GTGGTACAGT CTGGAGGATC 
0241 CCACTGGCGG GTGGAAGAAC GAGCAGGTGA CCACGGCGCT CTGGGACGAG CTTATCTCCG 
0301 ATCTTACGGG TCTGTGTCGC GAAGCAGCCG AGAAAATGCT CTGCGCCTAT GCGTTTCCCA 
0361 ACTGCCACAT GGAGGGCGGT CGAGCGGTGA AGGCTCCTCT CTGCTTCGAG GATTGCCAGG 
0421 CCACGCATCT CCAGTTCTGC TACAACGACT GGGTGCTCAT CGAGGAGAAG AAGGAGCGAA 
0481 ATATGTTCAT CAAGAGCCGC GG 
 in silico PCR Fragment
0001 CTCCGGGGAA TGGTGCTGAA ATGGGGGGCC AATTTGGCTG TCCTGGGGCT GTGCGTGTTT 
0061 CTCTTTGCC- AGCGCCACGC ACGCGAACTC CCTGAACGCC ATCGAGGAGC CCGTCACCCG 
0121 GCGACACCAC CAGCGGCATC ACGAGCGCGA GCGGGAGGAG AACGGCTACT GCG-CCCCGT 
0181 ACAGCGGCAA GGTGTGCAAG GAATACCTCA CCGGCCAGGT GTGGTACAGT CTGGAGGATC 
0241 CCACTGGCGG GTGGAAGAAC GAGCAGGTGA CCACGGCGCT CTGGGACGAG CTTATCTCCG 
0301 ATCTTACGGG TCTGTGTCGC GAAGCAGCCG AGAAAATGCT CTGCGCCTAT GCGTTTCCCA 
0361 ACTGCCACAT GGAGGGCGGT CGAGCGGTGA AGGCTCCTCT CTGCTTCGAG GATTGCCAGG 
0421 CCACGCATCT CCAGTTCTGC TACAACGACT GGGTGCTCAT CGAGGAGAAG AAGGAGCGAA 
0481 ATATGTTCAT CAAGAGCCGC GG 
 Assemble Data

4007R-3.IR_full       1   CTCCGGGGAATGGTGCTGAAATGGGGGGCCAATTTGGCTGTCCTGGGGCTGTGCGTGTTT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4007R-3.in silico     1   CTCCGGGGAATGGTGCTGAAATGGGGGGCCAATTTGGCTGTCCTGGGGCTGTGCGTGTTT 60


4007R-3.IR_full       61  CTCTTTGCCAAGCGCCACGCACGCGAACTCCCTGAACGCCATCGAGGAGCCCGTCACCCG 120
                          ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
4007R-3.in silico     61  CTCTTTGCC-AGCGCCACGCACGCGAACTCCCTGAACGCCATCGAGGAGCCCGTCACCCG 120


4007R-3.IR_full       121 GCGACACCACCAGCGGCATCACGAGCGCGAGCGGGAGGAGAACGGCTACTGCGCCTCCGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||
4007R-3.in silico     121 GCGACACCACCAGCGGCATCACGAGCGCGAGCGGGAGGAGAACGGCTACTGCG-CCCCGT 180


4007R-3.IR_full       181 ACAGCGGCAAGGTGTGCAAGGAATACCTCACCGGCCAGGTGTGGTACAGTCTGGAGGATC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4007R-3.in silico     181 ACAGCGGCAAGGTGTGCAAGGAATACCTCACCGGCCAGGTGTGGTACAGTCTGGAGGATC 240


4007R-3.IR_full       241 CCACTGGCGGGTGGAAGAACGAGCAGGTGACCACGGCGCTCTGGGACGAGCTTATCTCCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4007R-3.in silico     241 CCACTGGCGGGTGGAAGAACGAGCAGGTGACCACGGCGCTCTGGGACGAGCTTATCTCCG 300


4007R-3.IR_full       301 ATCTTACGGGTCTGTGTCGCGAAGCAGCCGAGAAAATGCTCTGCGCCTATGCGTTTCCCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4007R-3.in silico     301 ATCTTACGGGTCTGTGTCGCGAAGCAGCCGAGAAAATGCTCTGCGCCTATGCGTTTCCCA 360


4007R-3.IR_full       361 ACTGCCACATGGAGGGCGGTCGAGCGGTGAAGGCTCCTCTCTGCTTCGAGGATTGCCAGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4007R-3.in silico     361 ACTGCCACATGGAGGGCGGTCGAGCGGTGAAGGCTCCTCTCTGCTTCGAGGATTGCCAGG 420


4007R-3.IR_full       421 CCACGCATCTCCAGTTCTGCTACAACGACTGGGTGCTCATCGAGGAGAAGAAGGAGCGAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
4007R-3.in silico     421 CCACGCATCTCCAGTTCTGCTACAACGACTGGGTGCTCATCGAGGAGAAGAAGGAGCGAA 480


4007R-3.IR_full       481 ATATGTTCATCAAGAGCCGCGG 502
                          ||||||||||||||||||||||
4007R-3.in silico     481 ATATGTTCATCAAGAGCCGCGG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057907.2  CG4007-RA (Nrk), mRNA 
0   NM_134504.2  CG14232-RA (CG14232), mRNA 
0   NM_168171.1  CG32397-RA (CG32397), mRNA 
0   NM_079534.1  CG1128-RB, transcript variant B (alpha-Est9), mRNA 
0   NM_169187.1  CG1128-RA, transcript variant A (alpha-Est9), mRNA 
0   NM_164719.1  CG32829-RA (CG32829), mRNA 
0   NM_132822.1  CG8119-RA (CG8119), mRNA 
0   NM_133147.1  CG8028-RA (CG8028), mRNA 
0   13  NM_136864.2  CG13185-RA (CG13185), mRNA 
0   10  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_164967.1  CG6509-RA, transcript variant A (CG6509), mRNA 
0   NM_135661.2  CG6509-RB, transcript variant B (CG6509), mRNA 
0   NM_166885.1  CG32813-RD, transcript variant D (CG32813), mRNA 
0   NM_079940.4  CG16973-RA, transcript variant A (msn), mRNA 
0   NM_079230.2  CG32386-RA (corn), mRNA 
0   NM_206249.2  CG16973-RE, transcript variant E (msn), mRNA 
0   NM_135992.2  CG6840-RA (Rpb11), mRNA 
0   NM_136690.2  CG1513-RA (CG1513), mRNA 
0   NM_206251.2  CG16973-RD, transcript variant D (msn), mRNA 
0   NM_206252.2  CG16973-RB, transcript variant B (msn), mRNA 
0   NM_206250.2  CG16973-RC, transcript variant C (msn), mRNA 
0   NM_136039.2  CG10211-RA (CG10211), mRNA 
0   NM_166337.1  CG11949-RB, transcript variant B (cora), mRNA 
0   NM_166336.1  CG11949-RC, transcript variant C (cora), mRNA 
0   NM_166338.1  CG11949-RD, transcript variant D (cora), mRNA 
0   NM_079067.2  CG11949-RA, transcript variant A (cora), mRNA 
0   NM_170430.2  CG31037-RA (ca), mRNA 
0   NM_078671.3  CG7098-RA (dik), mRNA 
0   14  NM_176446.1  CG33208-RD, transcript variant D (MICAL), mRNA 
0   14  NM_176448.1  CG33208-RG, transcript variant G (MICAL), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.