National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3998R-2 
 Symbol zf30C  Full Name Zinc finger protein 30C 
 CG No CG3998  Old CG No CG3998 
 Synonyms CG3998, l(2)k02506, clone 1.52, anon-EST:Liang-1.52, zf30C, Zf30c 
 Accession No (Link to NCBI) NM_057953.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
[Please submit your publication]
Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| silico     1   CGAGTCGATGGCTCCAAGCAGCAGTGCGGCGGCTGCAGCCACCAAGCTCCTGGTGGAGAT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CACCACCGACGGAATACCCAAGCTGCACTGCCCGGTGTGCAACAAGGCGCTGGTCTCCCT 120

                          |||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||| silico     121 AGCCGGATATGTGAAGCACGTAAAGAAGCACCAGCCGCCGGGCGGCTTCG-AGTGCCGTC 180

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     181 ACTGCGATGCTCGGTTTTGCCACGAGGAGGAGCTCACCCAGCATGCAAAGGATGA-GCAC 240

                          |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| silico     241 GGAGTCACTGGCGCGGTAGCTG-GACAGGAGCGAAAGCCTTTCGTTTGTGAAAAGTGCGG 300

                          ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| silico     301 CGCGGAGTACAAGTACCAGGAGGCATA-CCGTCGCCACTGCAGGACCAAGTGTGGCGAGG 360

                          |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| silico     361 AAAAGCTACCCAGGGAGGAATCCCGACCAATGGAGTGCAAGTGC-TGCTACACCCGCTTC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCTAGCGCCTCTAACCTATCCAAGCATCGACGCAGTCGTCCCGACACCTGTGGACAGCCG 480

                          ||||||||||||||||||||||||| silico     481 GAATACGATTCGCCCGGTTCATCCG 505

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057953.3  CG3998-RA (zf30C), mRNA 
0.2   NM_143508.1  CG7928-RA (CG7928), mRNA 
0   NM_132830.1  CG15601-RA (CG15601), mRNA 
0   NM_141658.3  CG8301-RA (CG8301), mRNA 
0   NM_080535.2  CG9774-RA (rok), mRNA 
0   NM_142709.2  CG10823-RA, transcript variant A (SIFR), mRNA 
0   NM_169955.2  CG10823-RB, transcript variant B (SIFR), mRNA 
0   10  NM_132259.2  CG11219-RA (PIP82), mRNA 
0   NM_001032250.1  CG30084-RE, transcript variant E (CG30084), mRNA 
0   NM_001043086.1  CG30084-RG, transcript variant G (CG30084), mRNA 
0   NM_165262.2  CG31753-RA (ham), mRNA 
0   NM_140803.1  CG14073-RB, transcript variant B (CG14073), mRNA 
0   NM_164735.1  CG11266-RG, transcript variant G (CG11266), mRNA 
0   NM_135251.2  CG11266-RB, transcript variant B (CG11266), mRNA 
0   NM_164730.1  CG11266-RA, transcript variant A (CG11266), mRNA 
0   NM_164733.1  CG11266-RD, transcript variant D (CG11266), mRNA 
0   NM_164731.1  CG11266-RE, transcript variant E (CG11266), mRNA 
0   NM_164734.1  CG11266-RF, transcript variant F (CG11266), mRNA 
0   NM_164732.1  CG11266-RC, transcript variant C (CG11266), mRNA 
0   NM_134486.1  CG14221-RA (CG14221), mRNA 
0   NM_176132.2  CG12052-RR, transcript variant R (lola), mRNA 
0   NM_080027.4  CG12052-RG, transcript variant G (lola), mRNA 
0   NM_080331.2  CG3578-RA (bi), mRNA 
0   NM_132252.3  CG1474-RA (Es2), mRNA 
0   NM_138132.1  CG9083-RA (CG9083), mRNA 
0   NM_164830.3  CG18405-RA, transcript variant A (Sema-1a), mRNA 
0   NM_135399.2  CG18405-RB, transcript variant B (Sema-1a), mRNA 
0   NM_080190.2  CG4152-RA (l(2)35Df), mRNA 
0   11  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_132578.1  CG11146-RA (CG11146), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.