National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3998R-1 
 Symbol zf30C  Full Name Zinc finger protein 30C 
 CG No CG3998  Old CG No CG3998 
 Synonyms CG3998, l(2)k02506, clone 1.52, anon-EST:Liang-1.52, zf30C, Zf30c 
 Accession No (Link to NCBI) NM_057953.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Jafari S, Alkhori L, Schleiffer A, Brochtrup A, Hummel T, Alenius M.
Combinatorial activation and repression by seven transcription factors specify Drosophila odorant receptor expression.
PLoS Biol. (2012) 10(3) e1001280 [ PubMed ID = 22427741 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGAGTCGATGGCTCCAAGCAG 
 Primer Seq. 3'
aatctagaggtaccCGGATGAACCGGGCGAATCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGAGTCGATG GCTCCAAGCA GCAGTgcNGC gGCTgNAGcC ACCAAGCTCC TGGTGGAGAT 
0061 CACCACCGAC GGAATACCCA AGCTGCACTG CCCGGTGTGC AACAAGGCGC TGGTCTCCCT 
0121 AGCCGGATAT GTGAAGCACG TAAAGAAGCA CCAGCCGCCG ggcGNCNTCG NAGTGCCGtC 
0181 ACTGCGATGC TCGGTTTTGC CACGAGGAGG AGCTCACCCA GCATGCAAAG GATGACGCAC 
0241 GGAgTCACTG GCGCGGTAGC TGNGACAGGA GCGAAAGCCT TTCGTTTGCG AAAAGTGCGG 
0301 CGCGGAGTAC AAGTACCAGG AGGCATANCC GTCGCCACTG CAGGACCAAG TGTGGCGAGG 
0361 AAAAGCTACC CAGGGAGGAA TCCCGACCAA TGGAGTGCAA GTGCNTGCTA CACCCGCTTC 
0421 TCTAGCGCCT CTAACCTATC CAAGCATCGA CGCAGtCGTC CCGACACCTG TGGACAGCCG 
0481 GAATACGATT CGCCCGGTTC ATCCG 
 in silico PCR Fragment
0001 CGAGTCGATG GCTCCAAGCA GCAGTGCGGC GGCTGCAGCC ACCAAGCTCC TGGTGGAGAT 
0061 CACCACCGAC GGAATACCCA AGCTGCACTG CCCGGTGTGC AACAAGGCGC TGGTCTCCCT 
0121 AGCCGGATAT GTGAAGCACG TAAAGAAGCA CCAGCCGCCG GGCGGCTTCG -AGTGCCGTC 
0181 ACTGCGATGC TCGGTTTTGC CACGAGGAGG AGCTCACCCA GCATGCAAAG GATGA-GCAC 
0241 GGAGTCACTG GCGCGGTAGC TG-GACAGGA GCGAAAGCCT TTCGTTTGTG AAAAGTGCGG 
0301 CGCGGAGTAC AAGTACCAGG AGGCATA-CC GTCGCCACTG CAGGACCAAG TGTGGCGAGG 
0361 AAAAGCTACC CAGGGAGGAA TCCCGACCAA TGGAGTGCAA GTGC-TGCTA CACCCGCTTC 
0421 TCTAGCGCCT CTAACCTATC CAAGCATCGA CGCAGTCGTC CCGACACCTG TGGACAGCCG 
0481 GAATACGATT CGCCCGGTTC ATCCG 
 Assemble Data

3998R-1.IR_full       1   CGAGTCGATGGCTCCAAGCAGCAGTGCNGCGGCTGNAGCCACCAAGCTCCTGGTGGAGAT 60
                          ||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||
3998R-1.in silico     1   CGAGTCGATGGCTCCAAGCAGCAGTGCGGCGGCTGCAGCCACCAAGCTCCTGGTGGAGAT 60


3998R-1.IR_full       61  CACCACCGACGGAATACCCAAGCTGCACTGCCCGGTGTGCAACAAGGCGCTGGTCTCCCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3998R-1.in silico     61  CACCACCGACGGAATACCCAAGCTGCACTGCCCGGTGTGCAACAAGGCGCTGGTCTCCCT 120


3998R-1.IR_full       121 AGCCGGATATGTGAAGCACGTAAAGAAGCACCAGCCGCCGGGCGNCNTCGNAGTGCCGTC 180
                          |||||||||||||||||||||||||||||||||||||||||||| | ||| |||||||||
3998R-1.in silico     121 AGCCGGATATGTGAAGCACGTAAAGAAGCACCAGCCGCCGGGCGGCTTCG-AGTGCCGTC 180


3998R-1.IR_full       181 ACTGCGATGCTCGGTTTTGCCACGAGGAGGAGCTCACCCAGCATGCAAAGGATGACGCAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
3998R-1.in silico     181 ACTGCGATGCTCGGTTTTGCCACGAGGAGGAGCTCACCCAGCATGCAAAGGATGA-GCAC 240


3998R-1.IR_full       241 GGAGTCACTGGCGCGGTAGCTGNGACAGGAGCGAAAGCCTTTCGTTTGCGAAAAGTGCGG 300
                          |||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||
3998R-1.in silico     241 GGAGTCACTGGCGCGGTAGCTG-GACAGGAGCGAAAGCCTTTCGTTTGTGAAAAGTGCGG 300


3998R-1.IR_full       301 CGCGGAGTACAAGTACCAGGAGGCATANCCGTCGCCACTGCAGGACCAAGTGTGGCGAGG 360
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
3998R-1.in silico     301 CGCGGAGTACAAGTACCAGGAGGCATA-CCGTCGCCACTGCAGGACCAAGTGTGGCGAGG 360


3998R-1.IR_full       361 AAAAGCTACCCAGGGAGGAATCCCGACCAATGGAGTGCAAGTGCNTGCTACACCCGCTTC 420
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
3998R-1.in silico     361 AAAAGCTACCCAGGGAGGAATCCCGACCAATGGAGTGCAAGTGC-TGCTACACCCGCTTC 420


3998R-1.IR_full       421 TCTAGCGCCTCTAACCTATCCAAGCATCGACGCAGTCGTCCCGACACCTGTGGACAGCCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3998R-1.in silico     421 TCTAGCGCCTCTAACCTATCCAAGCATCGACGCAGTCGTCCCGACACCTGTGGACAGCCG 480


3998R-1.IR_full       481 GAATACGATTCGCCCGGTTCATCCG 505
                          |||||||||||||||||||||||||
3998R-1.in silico     481 GAATACGATTCGCCCGGTTCATCCG 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057953.3  CG3998-RA (zf30C), mRNA 
0.2   NM_143508.1  CG7928-RA (CG7928), mRNA 
0   NM_132830.1  CG15601-RA (CG15601), mRNA 
0   NM_141658.3  CG8301-RA (CG8301), mRNA 
0   NM_080535.2  CG9774-RA (rok), mRNA 
0   NM_142709.2  CG10823-RA, transcript variant A (SIFR), mRNA 
0   NM_169955.2  CG10823-RB, transcript variant B (SIFR), mRNA 
0   10  NM_132259.2  CG11219-RA (PIP82), mRNA 
0   NM_001032250.1  CG30084-RE, transcript variant E (CG30084), mRNA 
0   NM_001043086.1  CG30084-RG, transcript variant G (CG30084), mRNA 
0   NM_165262.2  CG31753-RA (ham), mRNA 
0   NM_140803.1  CG14073-RB, transcript variant B (CG14073), mRNA 
0   NM_164735.1  CG11266-RG, transcript variant G (CG11266), mRNA 
0   NM_135251.2  CG11266-RB, transcript variant B (CG11266), mRNA 
0   NM_164730.1  CG11266-RA, transcript variant A (CG11266), mRNA 
0   NM_164733.1  CG11266-RD, transcript variant D (CG11266), mRNA 
0   NM_164731.1  CG11266-RE, transcript variant E (CG11266), mRNA 
0   NM_164734.1  CG11266-RF, transcript variant F (CG11266), mRNA 
0   NM_164732.1  CG11266-RC, transcript variant C (CG11266), mRNA 
0   NM_134486.1  CG14221-RA (CG14221), mRNA 
0   NM_176132.2  CG12052-RR, transcript variant R (lola), mRNA 
0   NM_080027.4  CG12052-RG, transcript variant G (lola), mRNA 
0   NM_080331.2  CG3578-RA (bi), mRNA 
0   NM_132252.3  CG1474-RA (Es2), mRNA 
0   NM_138132.1  CG9083-RA (CG9083), mRNA 
0   NM_164830.3  CG18405-RA, transcript variant A (Sema-1a), mRNA 
0   NM_135399.2  CG18405-RB, transcript variant B (Sema-1a), mRNA 
0   NM_080190.2  CG4152-RA (l(2)35Df), mRNA 
0   11  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_132578.1  CG11146-RA (CG11146), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.