National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3996R-4 
 Symbol CG3996  Full Name CG3996 
 CG No CG3996  Old CG No CG3996 
 Synonyms CG3996 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCATTACCAGTGCCCGCCTAAC 
 Primer Seq. 3'
aatctagaggtaccAGCCCAGTAGGATGCGCTTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CATTACCAGT GCCCGCCTAA CCTCGCCCAC TAAAAACAGC CTCAGCAGCA ACAACACCAT 
0061 CACCACCCCC GGCAGCAATA ATAGAAGCCC CAGCAGCACC AAAACCACCA TGCTGACCCG 
0121 CAATGGCGGA GGCCACGGGA CCAGCCCCAC TGCCTCCGGA TCCGGACACG CCCCCTCCGC 
0181 CACCGCCGCT GCCGACGATG AAGCCACCTC GGATTACAAC CAGTGGCTGC ATGCCATGAA 
0241 ACTGGTGGCC CGCCTGCCCG GAGGCACTCC ACCCGAGTTC CGACGCAAGT TGTGGCTCTC 
0301 GCTGGCGGAC AAGTATCTCA AGTCGAAGAA CGTGGACTGG GCGCAGCAGA GGGAGAAGTG 
0361 CTTTTGCGAG GAGTGGCGCG AGGACGACGA GGAGCTGGGC ATACAAATCG TCAAGGACCT 
0421 GCATCGCACT GGCTCGAATC TGTGCACCGG TCCCGCGGGC TCCATAAACC AGGCCAAGCT 
0481 GAAGCGCATC CTACTGGGCT  
 in silico PCR Fragment
0001 CATTACCAGT GCCCGCCTAA CCTCGCCCAC TAAAAACAGC CTCAGCAGCA ACAACACCAT 
0061 CACCACCCCC GGCAGCAATA ATAGAAGCCC CAGCAGCACC AAAACCACCA TGCTGACCCG 
0121 CAATGGCGGA GGCCACGGGA CCAGCCCCAC TGCCTCCGGA TCCGGACACG CCCCCTCCGC 
0181 CACCGCCGCT GCCGACGATG AAGCCACCTC GGATTACAAC CAGTGGCTGC ATGCCATGAA 
0241 ACTGGTGGCC CGCCTGCCCG GAGGCACTCC ACCCGAGTTC CGACGCAAGT TGTGGCTCTC 
0301 GCTGGCGGAC AAGTATCTCA AGTCGAAGAA CGTGGACTGG GCGCAGCAGA GGGAGAAGTG 
0361 CTTTTGCGAG GAGTGGCGCG AGGACGACGA GGAGCTGGGC ATACAAATCG TCAAGGACCT 
0421 GCATCGCACT GGCTCGAATC TGTGCACCGG TCCCGCGGGC TCCATAAACC AGGCCAAGCT 
0481 GAAGCGCATC CTACTGGGCT  
 Assemble Data

11300Ra-2.IR full       1   CCTTTGGGCTTTTGGCCCTAATAGCAACTGCCTACGCCGATTCTCCACCTGCGGCAGGAT 60
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11300Ra-2.in silico     1   CCTTTGGGCTTTTGGCCCTAATAGCAACTGCCTACGCCGATTCTCCACCTGCGGCAGGAT 60


11300Ra-2.IR full       61  CCCCACCCGCGTCATCTCCACCGGCTGGAACCCCAACCTCGTCACCTCCAGCGACTGGAA 120
                            ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
11300Ra-2.in silico     61  CCCCACCCGCGTCATCTCCACCGGCTGGAACCCCAACCTCGCCACCTCCAGCGACTGGAA 120


11300Ra-2.IR full       121 CACCGCCCTCACCATCCCCAGCGACTGGAACACCACCTTCAGCATCCCCAGCTGCTGGTA 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11300Ra-2.in silico     121 CACCGCCCTCACCATCCCCAGCGACTGGAACACCACCTTCAGCATCCCCAGCTGCTGGTA 180


11300Ra-2.IR full       181 CACCGACCTCGCCAACTCCAGCGACTGGAACACCGTCCTCGCCAGCTACTCCTGATGCGC 240
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11300Ra-2.in silico     181 CACCGACCTCGCCAACTCCAGCGACTGGAACACCGTCCTCGCCAGCTACTCCTGATGCGC 240


11300Ra-2.IR full       241 CCGCTTCCTCGACATCACCAGCTACGCCCACATCGCCCAGTGACAGTGGATCCAGCAGCA 300
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11300Ra-2.in silico     241 CCGCTTCCTCGACATCACCAGCTACGCCCACATCGCCCAGTGACAGTGGATCCAGCAGCA 300


11300Ra-2.IR full       301 GCCAGGAAGTGATTAGGCTCAGGCGTCGGCTGCGGGTGAGGCGTCANTNCCGCCGCGAGA 360
                            ||||||||||||||||||||||||||||||||||                  |||   ||
11300Ra-2.in silico     301 GCCAGGAAGTGATTAGGCTCAGGCGTCGGCTGCG------------------CCGGCTGA 360


11300Ra-2.IR full       361 GGCNTCA-CTCCGCCGCGAGAGGCGTCAGGCCAACCAGAGTAATCAGAATGGAGGTGGTG 420
                            ||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
11300Ra-2.in silico     361 GGCGTCAGCTCCGCCGCGAGAGGCGTCAGGCCAACCAGAGTAATCAGAATGGAGGTGGTG 420


11300Ra-2.IR full       421 GTCAGGGGCGAGTGGTTCGCCGTGTACACCGTCACCGTCGTCTATTG 467
                            |||||||||||||||||||||||||||||||||||||||||||||||
11300Ra-2.in silico     421 GTCAGGGGCGAGTGGTTCGCCGTGTACACCGTCACCGTCGTCTATTG 467

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.