National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3982R-2 
 Symbol CG3982  Full Name CG3982 
 CG No CG3982  Old CG No CG3982 
 Synonyms bs12d10.y1, CG3982 
 Accession No (Link to NCBI) NM_170633.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCTATCATGCCTCCAAGAC 
 Primer Seq. 3'
aatctagaggtaccCGTACTGCTGTTGCATTTGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGCTATCAT GCCTCCAAGA CGAGCGTTGC TTCACGCCAT GCCGCTGGTG GTGGAGTAGC 
0061 ACCGGCAGTG GGTCGCAAGC AGGTCAGTCA GGTCAGCCTG ACGCCNCAGC CAGTCAAGGA 
0121 ATACCAATGC CACCGAAAAT CCACTCAAGA GTCCATTGGA CGCTNTTAAG CCGCAGCGGC 
0181 CCCGTACGCA ATCAGAATCC CTTNCCAGCG TCGCTCTGGC TTGCAGGATG TCGATGATGG 
0241 CTTTTCTGGC ATCCAACATT TTTGCTCGAC CGTCCCGTGT CCGCCATTCT GGACTTGATC 
0301 GGGAGATTCA TGCCACAGGC CGCAGTAGGA GGAGCAGTAG CTGGTGGACA GCAAGCATCG 
0361 CCTCCCATTC CCACCCAGCA GCAGCATCAT CATCAACAGC AGCAGCAGCA GTATCAGCAG 
0421 ATACCCCCAG TGGATGCCGT GCCACAGCAG CAGAtggCTC CGCCGGCAGT GGTgNCACAG 
0481 CAGCAGCAAA TGCAACAGCA GTACG 
 in silico PCR Fragment
0001 TGGCTATCAT GCCTCCAAGA CGAGCGTTGC TTCACGCCAT GCCGCTGGTG GTGGAGTAGC 
0061 ACCGGCAGTG GGTCGCAAGC AGGTCAGTCA GGTCAGCCTG ACGCC-CAGC CAGTCAAGGA 
0121 ATACCAATGC CACCGAAAAT CCACTCAAGA GTCCATTGGA CGCT-TTAAG CCGCAGCGGC 
0181 CCCGTACGCA ATCAGAATCC CTT-CCAGCG TCGCTCTGGC TTGCAGGATG TCGATGA-GG 
0241 CTTTTCTGGC ATCCAACATT TTTGCTCGAC CGTCCCGTGT CCGCCATTCT GGACTTGATC 
0301 GGGAGA-TCA TGCCACAGGC CGCAGTAGGA GGAGCAGTAG CTGGTGGACA GCAAGCATCG 
0361 CCTCCCATTC CCACCCAGCA GCAGCATCAT CAACAGCAGC AGCAGCAGCA GTATCAGCAG 
0421 ATACCCCCAG TGGATGCCGT GCCACAGCAG CAGATGGCTC CGCCGGCAGT GGTGCCACAG 
0481 CAGCAGCAAA TGCAACAGCA GTACG 
 Assemble Data

3982R-2.IR_full       1   TGGCTATCATGCCTCCAAGACGAGCGTTGCTTCACGCCATGCCGCTGGTGGTGGAGTAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3982R-2.in silico     1   TGGCTATCATGCCTCCAAGACGAGCGTTGCTTCACGCCATGCCGCTGGTGGTGGAGTAGC 60


3982R-2.IR_full       61  ACCGGCAGTGGGTCGCAAGCAGGTCAGTCAGGTCAGCCTGACGCCNCAGCCAGTCAAGGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
3982R-2.in silico     61  ACCGGCAGTGGGTCGCAAGCAGGTCAGTCAGGTCAGCCTGACGCC-CAGCCAGTCAAGGA 120


3982R-2.IR_full       121 ATACCAATGCCACCGAAAATCCACTCAAGAGTCCATTGGACGCTNTTAAGCCGCAGCGGC 180
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
3982R-2.in silico     121 ATACCAATGCCACCGAAAATCCACTCAAGAGTCCATTGGACGCT-TTAAGCCGCAGCGGC 180


3982R-2.IR_full       181 CCCGTACGCAATCAGAATCCCTTNCCAGCGTCGCTCTGGCTTGCAGGATGTCGATGATGG 240
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||
3982R-2.in silico     181 CCCGTACGCAATCAGAATCCCTT-CCAGCGTCGCTCTGGCTTGCAGGATGTCGATGA-GG 240


3982R-2.IR_full       241 CTTTTCTGGCATCCAACATTTTTGCTCGACCGTCCCGTGTCCGCCATTCTGGACTTGATC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3982R-2.in silico     241 CTTTTCTGGCATCCAACATTTTTGCTCGACCGTCCCGTGTCCGCCATTCTGGACTTGATC 300


3982R-2.IR_full       301 GGGAGATTCATGCCACAGGCCGCAGTAGGAGGAGCAGTAGCTGGTGGACAGCAAGCATCG 360
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
3982R-2.in silico     301 GGGAGA-TCATGCCACAGGCCGCAGTAGGAGGAGCAGTAGCTGGTGGACAGCAAGCATCG 360


3982R-2.IR_full       361 CCTCCCATTCCCACCCAGCAGCAGCATCATCATCAACAGCAGCAGCAGCAGTATCAGCAG 420
                          |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||
3982R-2.in silico     361 CCTCCCATTCCCACCCAGCAGCAGCATCATCAACAGCAGCAGCAGCAGCAGTATCAGCAG 420


3982R-2.IR_full       421 ATACCCCCAGTGGATGCCGTGCCACAGCAGCAGATGGCTCCGCCGGCAGTGGTGNCACAG 480
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
3982R-2.in silico     421 ATACCCCCAGTGGATGCCGTGCCACAGCAGCAGATGGCTCCGCCGGCAGTGGTGCCACAG 480


3982R-2.IR_full       481 CAGCAGCAAATGCAACAGCAGTACG 505
                          |||||||||||||||||||||||||
3982R-2.in silico     481 CAGCAGCAAATGCAACAGCAGTACG 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  32  143  NM_170633.1  CG3982-RA (CG3982), mRNA 
6.84   33  259  1058  2568  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
6.84   33  259  1058  2568  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
6.84   33  259  1058  2568  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
3.11   15  50  210  517  NM_057496.3  CG5058-RC, transcript variant C (grh), mRNA 
3.11   15  50  210  517  NM_057497.3  CG5058-RD, transcript variant D (grh), mRNA 
2.48   12  68  245  790  NM_168571.2  CG32133-RA (CG32133), mRNA 
2.48   12  43  237  605  NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
2.48   12  43  226  535  NM_001042894.1  CG5461-RF, transcript variant F (bun), mRNA 
2.48   12  38  273  725  NM_139493.2  CG2083-RA (CG2083), mRNA 
2.48   12  34  106  202  NM_142100.2  CG8524-RA, transcript variant A (NK7.1), mRNA 
2.48   12  34  106  202  NM_169580.1  CG8524-RB, transcript variant B (NK7.1), mRNA 
2.28   11  98  413  1131  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
2.28   11  98  413  1131  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
2.28   11  78  277  711  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
2.28   11  78  277  711  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
2.28   11  58  182  528  NM_132246.2  CG10555-RA (CG10555), mRNA 
2.28   11  47  161  489  NM_001038742.1  CG6824-RD, transcript variant D (ovo), mRNA 
2.28   11  47  161  487  NM_080338.3  CG6824-RA, transcript variant A (ovo), mRNA 
2.28   11  39  127  403  NM_167027.2  CG6824-RC, transcript variant C (ovo), mRNA 
2.28   11  39  127  403  NM_167026.2  CG6824-RB, transcript variant B (ovo), mRNA 
2.28   11  32  192  443  NM_078514.2  CG9653-RA (brk), mRNA 
2.07   10  66  302  718  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
2.07   10  61  262  569  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
2.07   10  39  189  428  NM_137212.2  CG30089-RA (CG30089), mRNA 
2.07   10  36  147  356  NM_057495.3  CG5058-RB, transcript variant B (grh), mRNA 
2.07   10  36  147  356  NM_057494.3  CG5058-RA, transcript variant A (grh), mRNA 
2.07   10  34  101  270  NM_140792.1  CG6896-RA (MYPT-75D), mRNA 
1.86   65  392  959  NM_001038734.1  CG16902-RC (Hr4), mRNA 
1.86   43  222  501  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.