National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3972R-1 
 Symbol Cyp4g1  Full Name Cytochrome P450-4g1 
 CG No CG3972  Old CG No CG3972 
 Synonyms 4g1, EG:165H7.1, CG3972, scgamma, T1, P450, ASC-T1, P-450, P-450-A, P450-A, Cyt-P450-A1, anon-WO0140519.102, Cyp4g1 
 Accession No (Link to NCBI) NM_080292.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GAGTATTGGCGCAGGAATAGCCGGGAATACCGCATGGTTGCCAATATACCATCCCCACCG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GAGTTGCCTATTTTGGGACAGGCTCATGTGGCCGCCGGCTTGAGCAATGCCGAGATCCTG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCCGTTGGCTTGGGTTACCTCAACAAGTACGGAGAAACCATGAAGGCCTGGTTGGGCAAC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTCCTGTTGGTGTTTCTAACCAATCCCAGTGACATCGAGTTGATCCTGAGTGGGCACCAG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CACTTGACCAAGGCGGAGGAGTATCGCTACTTCAAGCCCTGGTTCGGTGATGGTCTACTG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATCAGCAATGGACATCATTGGCGTCATCATCGTAAGATGATTGCCCCCACCTTCCACCAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGCATCTTGAAGAGCTTCGTGCCTACATTTGTGGATCACTCAAAGGCGGTAGTTGCCAGG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATGGGCTTAGAAGCGGGCAAATCCTTTGATGTTCATGACTATATGTCGCAGACCACGGTT 480

3972R-1.IR_full       481 GACATCCTGTTGTCTACCGC 500
                          |||||||||||||||||||| silico     481 GACATCCTGTTGTCTACCGC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080292.2  CG3972-RA (Cyp4g1), mRNA 
0   NM_140979.1  CG18281-RA (CG18281), mRNA 
0   NM_001042822.1  CG34120-RC, transcript variant C (CG34120), mRNA 
0   NM_139464.2  CG32306-RB, transcript variant B (CG32306), mRNA 
0   NM_206242.1  CG32306-RD, transcript variant D (CG32306), mRNA 
0   NM_143030.2  CG18410-RA (CG18410), mRNA 
0   10  NM_166610.1  CG5393-RD, transcript variant D (apt), mRNA 
0   10  NM_166611.1  CG5393-RE, transcript variant E (apt), mRNA 
0   10  NM_057832.3  CG5393-RA, transcript variant A (apt), mRNA 
0   10  NM_166609.1  CG5393-RC, transcript variant C (apt), mRNA 
0   10  NM_057831.3  CG5393-RB, transcript variant B (apt), mRNA 
0   NM_134885.2  CG8814-RA (CG8814), mRNA 
0   NM_137942.1  CG13550-RA (CG13550), mRNA 
0   NM_001043280.1  CG34149-RA (CG34149), mRNA 
0   NM_143006.1  CG13617-RA (CG13617), mRNA 
0   NM_079730.2  CG6669-RA (klg), mRNA 
0   NM_169780.2  CG31247-RB, transcript variant B (tinc), mRNA 
0   NM_176510.1  CG31247-RD, transcript variant D (tinc), mRNA 
0   NM_176509.1  CG31247-RA, transcript variant A (tinc), mRNA 
0   NM_132395.1  CG2898-RA (CG2898), mRNA 
0   NM_080533.3  CG10683-RA (rhi), mRNA 
0   NM_135112.1  CG11030-RA (CG11030), mRNA 
0   NM_139624.2  CG11586-RA (CG11586), mRNA 
0   NM_143283.1  CG5882-RA (CG5882), mRNA 
0   NM_169584.1  CG31330-RA (CG31330), mRNA 
0   NM_001038882.1  CG4622-RB, transcript variant B (CG4622), mRNA 
0   NM_138085.2  CG4622-RA, transcript variant A (CG4622), mRNA 
0   NM_176447.1  CG33208-RF, transcript variant F (MICAL), mRNA 
0   NM_176445.1  CG33208-RC, transcript variant C (MICAL), mRNA 
0   NM_176449.1  CG33208-RH, transcript variant H (MICAL), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.