National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3969R-1 
 Symbol PR2  Full Name Fak-like tyrosine kinase 
 CG No CG3969  Old CG No CG3969 
 Synonyms DPR2, PR2/ACK, CG3969, DmHD-11, DRODPR2, dACK, Rp2, HD-11, PR2 
 Accession No (Link to NCBI) NM_057738.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTATACCGGCGGACTCCATTA 
 Primer Seq. 3'
aatctagaggtaccCTTGTAGTAGTCCTTGCCCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTATACCGGC GGACTCCATT AGTGTAAACA AACAGTTGGG AACCGGCGAA TTTGGGATCG 
0061 TCCAACAGGG AGTCTGGTCC AATGGCAACG AACGGATCCA AGTGGCTATT AAGTGCCTGT 
0121 GCCGAGAGCG CATGCAGTCA AATCCCATGG AGTTCCTTAA GGAAGCGGCC ATCATGCATT 
0181 CCATCGAGCA CGAGAATATC GTGCNCCTAT ATGGCGTNTG TCCTGGCCAC TNGACNTCGC 
0241 TCATGCTGGT CACTGAGCTC GCCCATCTGA GATCACTGTT GGAATGTCTC AAGGATTCGG 
0301 GACTGCGAGT CAGTTTCCTC ACCATACCCA CGCTCTGTGA GTTCGCCCTA CAGATCTGCA 
0361 ATGGAATGCG CTATTTGGAA CAGAAGCGCC TCATCCACAG AGACCTTGCG GCGCGAAATA 
0421 TTTTAGTGTT CAGCAAGGAC AAGGTCAAGA TCTCCGACTT TGGCCTGTCG CGGGCACTGG 
0481 GCGTGGGCAA GGACTACTAC AAG 
 in silico PCR Fragment
0001 TTATACCGGC GGACTCCATT AGTGTAAACA AACAGTTGGG AACCGGCGAA TTTGGGATCG 
0061 TCCAACAGGG AGTCTGGTCC AATGGCAACG AACGGATCCA AGTGGCTATT AAGTGCCTGT 
0121 GCCGAGAGCG CATGCAGTCA AATCCCATGG AGTTCCTTAA GGAAGCGGCC ATCATGCATT 
0181 CCATCGAGCA CGAGAATATC GTGCGCCTAT ATGGCGT-TG TCCTGGCCAC T-GAC-TCGC 
0241 TCATGCTGGT CACTGAGCTC GCCCATCTGA GATCACTGTT GGAATGTCTC AAGGATTCGG 
0301 GACTGCGAGT CAGTTTCCTC ACCATACCCA CGCTCTGTGA GTTCGCCCTA CAGATCTGCA 
0361 ATGGAATGCG CTATTTGGAA CAGAAGCGCC TCATCCACAG AGACCTTGCG GCGCGAAATA 
0421 TTTTAGTGTT CAGCAAGGAC AAGGTCAAGA TCTCCGACTT TGGCCTGTCG CGGGCACTGG 
0481 GCGTGGGCAA GGACTACTAC AAG 
 Assemble Data

3969R-1.IR_full       1   TTATACCGGCGGACTCCATTAGTGTAAACAAACAGTTGGGAACCGGCGAATTTGGGATCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3969R-1.in silico     1   TTATACCGGCGGACTCCATTAGTGTAAACAAACAGTTGGGAACCGGCGAATTTGGGATCG 60


3969R-1.IR_full       61  TCCAACAGGGAGTCTGGTCCAATGGCAACGAACGGATCCAAGTGGCTATTAAGTGCCTGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3969R-1.in silico     61  TCCAACAGGGAGTCTGGTCCAATGGCAACGAACGGATCCAAGTGGCTATTAAGTGCCTGT 120


3969R-1.IR_full       121 GCCGAGAGCGCATGCAGTCAAATCCCATGGAGTTCCTTAAGGAAGCGGCCATCATGCATT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3969R-1.in silico     121 GCCGAGAGCGCATGCAGTCAAATCCCATGGAGTTCCTTAAGGAAGCGGCCATCATGCATT 180


3969R-1.IR_full       181 CCATCGAGCACGAGAATATCGTGCNCCTATATGGCGTNTGTCCTGGCCACTNGACNTCGC 240
                          |||||||||||||||||||||||| |||||||||||| ||||||||||||| ||| ||||
3969R-1.in silico     181 CCATCGAGCACGAGAATATCGTGCGCCTATATGGCGT-TGTCCTGGCCACT-GAC-TCGC 240


3969R-1.IR_full       241 TCATGCTGGTCACTGAGCTCGCCCATCTGAGATCACTGTTGGAATGTCTCAAGGATTCGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3969R-1.in silico     241 TCATGCTGGTCACTGAGCTCGCCCATCTGAGATCACTGTTGGAATGTCTCAAGGATTCGG 300


3969R-1.IR_full       301 GACTGCGAGTCAGTTTCCTCACCATACCCACGCTCTGTGAGTTCGCCCTACAGATCTGCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3969R-1.in silico     301 GACTGCGAGTCAGTTTCCTCACCATACCCACGCTCTGTGAGTTCGCCCTACAGATCTGCA 360


3969R-1.IR_full       361 ATGGAATGCGCTATTTGGAACAGAAGCGCCTCATCCACAGAGACCTTGCGGCGCGAAATA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3969R-1.in silico     361 ATGGAATGCGCTATTTGGAACAGAAGCGCCTCATCCACAGAGACCTTGCGGCGCGAAATA 420


3969R-1.IR_full       421 TTTTAGTGTTCAGCAAGGACAAGGTCAAGATCTCCGACTTTGGCCTGTCGCGGGCACTGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3969R-1.in silico     421 TTTTAGTGTTCAGCAAGGACAAGGTCAAGATCTCCGACTTTGGCCTGTCGCGGGCACTGG 480


3969R-1.IR_full       481 GCGTGGGCAAGGACTACTACAAG 503
                          |||||||||||||||||||||||
3969R-1.in silico     481 GCGTGGGCAAGGACTACTACAAG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057738.3  CG3969-RA, transcript variant A (PR2), mRNA 
100   482  NM_057739.3  CG3969-RB, transcript variant B (PR2), mRNA 
0.2   NM_137688.1  CG3216-RA, transcript variant A (CG3216), mRNA 
0.2   NM_166415.1  CG3216-RB, transcript variant B (CG3216), mRNA 
0   NM_166185.1  CG5072-RC, transcript variant C (Cdk4), mRNA 
0   NM_166184.1  CG5072-RA, transcript variant A (Cdk4), mRNA 
0   NM_057848.2  CG5072-RB, transcript variant B (Cdk4), mRNA 
0   NM_080033.2  CG1624-RC, transcript variant C (dpld), mRNA 
0   NM_165534.1  CG1624-RB, transcript variant B (dpld), mRNA 
0   NM_165533.1  CG1624-RA, transcript variant A (dpld), mRNA 
0   NM_058144.2  CG11420-RA (png), mRNA 
0   NM_142706.2  CG3308-RA (CG3308), mRNA 
0   NM_142705.1  CG5919-RA (CG5919), mRNA 
0   NM_170088.1  CG10230-RB, transcript variant B (Rpn9), mRNA 
0   NM_142920.1  CG10230-RA, transcript variant A (Rpn9), mRNA 
0   NM_169054.1  CG12162-RB, transcript variant B (CG12162), mRNA 
0   NM_141283.2  CG12162-RA, transcript variant A (CG12162), mRNA 
0   NM_142581.1  CG4562-RA (CG4562), mRNA 
0   NM_139602.2  CG14992-RA (Ack), mRNA 
0   NM_142248.2  CG31183-RA (CG31183), mRNA 
0   NM_137160.1  CG17453-RA (Cyp317a1), mRNA 
0   NM_168387.1  CG6711-RA (Taf2), mRNA 
0   NM_132622.1  CG18646-RA (CG18646), mRNA 
0   NM_134645.2  CG11376-RA (CG11376), mRNA 
0   NM_132950.1  CG13002-RA (CG13002), mRNA 
0   NM_138175.2  CG7020-RA (DIP2), mRNA 
0   NM_134742.2  CG5001-RA (CG5001), mRNA 
0   14  NM_057410.3  CG10079-RA, transcript variant A (Egfr), mRNA 
0   14  NM_057411.3  CG10079-RB, transcript variant B (Egfr), mRNA 
0   NM_057501.3  CG7873-RA, transcript variant A (Src42A), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.