National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3954R-2 
 Symbol csw  Full Name corkscrew 
 CG No CG3954  Old CG No CG3954 
 Synonyms csw, Csw, EG:BACN25G24.2, CG3954, Csw/Shp2, l(1)2Db, E(sev)1A, CSW, l(1)G0170, l(1)2Dd, l(1)csw, 19-106, l(1)GA114, anon-WO03040301.219, anon-WO03040301.209, anon-WO03040301.207, Shp2/csw 
 Accession No (Link to NCBI) NM_057782.3 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTGAGAAACTGCTGCAGGAG 
 Primer Seq. 3'
aatctagaggtaccAGTTCCGACAAGGTGCCAAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 gCTGNAGAAA CTGCTGCAGG AGCNGGGATT CGACGGCTCC TTCCTCGCCC GCCTCTCCTC 
0061 CTCGAATCCG GGCGCCTTCC ACGCTCTCCG TGCGCCGCGG CAACGAGGTG ACCCACATCA 
0121 AAATCCAAAA CAATGGCGAC TTCTTTGATC TCTACGGTGG TGAAAAGTTC GCCACACTGC 
0181 CGGAACTGGT ACAATACTAC ATGGAGAATG GCGAGCTAAA GGAGAAGAAC GGCCAGGCCA 
0241 TCGAACTCAA GCAGCCGCTG ATCTGCGCCG AGCCCACCAC GGAAAGATGG TTTCATGGCA 
0301 ATCTTTCCGG AAAGGAAGCG GAAAAATTGA TCCTGGAGCG GGGCAAGAAT GGTTCGTTTC 
0361 TCGTCCGTGA ATCTCAGAGC AAGCCTGGCG ANCTTCGTCC TTTCCGTGCG CACGGACGAC 
0421 AAAGTAACGC ATGTCATGAT TCGATGGCAG GACAAGAAGT ACGACGTCGG CGGCGGGGAA 
0481 TCCTTTGGCA CCTTGTCGGA ACT 
 in silico PCR Fragment
0001 GCTG-AGAAA CTGCTGCAGG AGCAGGGATT CGACGGCTCC TTCCTCGCCC GCCTCTCCTC 
0061 CTCGAATCCG GGCGCCTT-C ACGCTCTCCG TGCGCCGCGG CAACGAGGTG ACCCACATCA 
0121 AAATCCAAAA CAATGGCGAC TTCTTTGATC TCTACGGTGG TGAAAAGTTC GCCACACTGC 
0181 CGGAACTGGT ACAATACTAC ATGGAGAATG GCGAGCTAAA GGAGAAGAAC GGCCAGGCCA 
0241 TCGAACTCAA GCAGCCGCTG ATCTGCGCCG AGCCCACCAC GGAAAGATGG TTTCATGGCA 
0301 ATCTTTCCGG AAAGGAAGCG GAAAAATTGA TCCTGGAGCG GGGCAAGAAT GGTTCGTTTC 
0361 TCGTCCGTGA ATCTCAGAGC AAGCCTGGCG A-CTTCGTCC TTTCCGTGCG CACGGACGAC 
0421 AAAGTAACGC ATGTCATGAT TCGATGGCAG GACAAGAAGT ACGACGTCGG CGGCGGGGAA 
0481 TCCTTTGGCA CCTTGTCGGA ACT 
 Assemble Data

3954R-2.IR_full       1   GCTGNAGAAACTGCTGCAGGAGCNGGGATTCGACGGCTCCTTCCTCGCCCGCCTCTCCTC 60
                          |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||
3954R-2.in silico     1   GCTG-AGAAACTGCTGCAGGAGCAGGGATTCGACGGCTCCTTCCTCGCCCGCCTCTCCTC 60


3954R-2.IR_full       61  CTCGAATCCGGGCGCCTTCCACGCTCTCCGTGCGCCGCGGCAACGAGGTGACCCACATCA 120
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
3954R-2.in silico     61  CTCGAATCCGGGCGCCTT-CACGCTCTCCGTGCGCCGCGGCAACGAGGTGACCCACATCA 120


3954R-2.IR_full       121 AAATCCAAAACAATGGCGACTTCTTTGATCTCTACGGTGGTGAAAAGTTCGCCACACTGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3954R-2.in silico     121 AAATCCAAAACAATGGCGACTTCTTTGATCTCTACGGTGGTGAAAAGTTCGCCACACTGC 180


3954R-2.IR_full       181 CGGAACTGGTACAATACTACATGGAGAATGGCGAGCTAAAGGAGAAGAACGGCCAGGCCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3954R-2.in silico     181 CGGAACTGGTACAATACTACATGGAGAATGGCGAGCTAAAGGAGAAGAACGGCCAGGCCA 240


3954R-2.IR_full       241 TCGAACTCAAGCAGCCGCTGATCTGCGCCGAGCCCACCACGGAAAGATGGTTTCATGGCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3954R-2.in silico     241 TCGAACTCAAGCAGCCGCTGATCTGCGCCGAGCCCACCACGGAAAGATGGTTTCATGGCA 300


3954R-2.IR_full       301 ATCTTTCCGGAAAGGAAGCGGAAAAATTGATCCTGGAGCGGGGCAAGAATGGTTCGTTTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3954R-2.in silico     301 ATCTTTCCGGAAAGGAAGCGGAAAAATTGATCCTGGAGCGGGGCAAGAATGGTTCGTTTC 360


3954R-2.IR_full       361 TCGTCCGTGAATCTCAGAGCAAGCCTGGCGANCTTCGTCCTTTCCGTGCGCACGGACGAC 420
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
3954R-2.in silico     361 TCGTCCGTGAATCTCAGAGCAAGCCTGGCGA-CTTCGTCCTTTCCGTGCGCACGGACGAC 420


3954R-2.IR_full       421 AAAGTAACGCATGTCATGATTCGATGGCAGGACAAGAAGTACGACGTCGGCGGCGGGGAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3954R-2.in silico     421 AAAGTAACGCATGTCATGATTCGATGGCAGGACAAGAAGTACGACGTCGGCGGCGGGGAA 480


3954R-2.IR_full       481 TCCTTTGGCACCTTGTCGGAACT 503
                          |||||||||||||||||||||||
3954R-2.in silico     481 TCCTTTGGCACCTTGTCGGAACT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057782.3  CG3954-RA, transcript variant A (csw), mRNA 
41.28   199  NM_166928.1  CG3954-RC, transcript variant C (csw), mRNA 
41.07   198  NM_057783.2  CG3954-RB, transcript variant B (csw), mRNA 
0.41   NM_079700.1  CG3723-RA (Dhc93AB), mRNA 
0.2   NM_001042878.1  CG13784-RC, transcript variant C (CG13784), mRNA 
0   NM_167399.4  CG12047-RB, transcript variant B (mud), mRNA 
0   NM_167400.3  CG12047-RA, transcript variant A (mud), mRNA 
0   NM_080495.3  CG12047-RC, transcript variant C (mud), mRNA 
0   NM_176041.1  CG33090-RB (CG33090), mRNA 
0   NM_143106.2  CG10425-RA (CG10425), mRNA 
0   NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_141345.2  CG10610-RA (ECSIT), mRNA 
0   NM_144020.1  CG18673-RA (CG18673), mRNA 
0   NM_138265.2  CG13916-RA (SA-2), mRNA 
0   NM_143420.2  CG11888-RA (Rpn2), mRNA 
0   10  NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_169778.1  CG31246-RA (CG31246), mRNA 
0   NM_133088.1  CG6632-RA (Ing3), mRNA 
0   NM_170538.1  CG31006-RB, transcript variant B (CG31006), mRNA 
0   NM_168899.1  CG32437-RA (CG32437), mRNA 
0   NM_170537.1  CG31006-RA, transcript variant A (CG31006), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_165701.1  CG1623-RE, transcript variant E (CG1623), mRNA 
0   NM_136676.2  CG1623-RC, transcript variant C (CG1623), mRNA 
0   NM_165698.1  CG1623-RA, transcript variant A (CG1623), mRNA 
0   NM_165700.1  CG1623-RD, transcript variant D (CG1623), mRNA 
0   NM_165699.1  CG1623-RB, transcript variant B (CG1623), mRNA 
0   NM_001032402.1  CG33957-RB, transcript variant B (cp309), mRNA 
0   NM_134551.4  CG32506-RA (CG32506), mRNA 
0   NM_168577.2  CG32134-RA, transcript variant A (btl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.