National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3938R-2 
 Symbol CycE  Full Name Cyclin E 
 CG No CG3938  Old CG No CG3938 
 Synonyms CyclE, DmCycE, cycE, cyclinE, DmcycE, Cyc E, D-CycE, fond, BG:DS07108.3, l(2)35Dd, CyeE, l(2)k05007, l(2)k02602, l(2)br37, DmcyclinE, unnamed, l35Dd, br37, CDI7, l(2)k02514, l(2)05206, cdi7, Cdi7, CG3938, CycE, CYCE 
 Accession No (Link to NCBI) NM_057611.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Dui W, Wei B, He F, Lu W, Li C, Liang X, Ma J, Jiao R.
The Drosophila F-box protein dSkp2 regulates cell proliferation by targeting Dacapo for degradation.
Mol Biol Cell (2013) 24(11) 1676-87, S1-7 [ PubMed ID = 23552694 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCACTGAGCCAAATGGCAGCATAGTCACAACCGCCCCCAGCAACGGAGAAGTGAGCAGCA 60

                          ||||||||||||||||||||||||||||||||||||||||||||| |||  ||||||||| silico     61  GCATAGTCGTCGTCGTCAGCAGCAGTAGTATCAGTAGCAGCAGCGATAGCCCAATCGCTA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCCTTCCACATCCAGATCCAATCCCATCAACATCGTTCTCTTCAGCGTCGCAACGAAGTG 180

                          | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 A-AGAGGAGCTACCAGGAACCTCAGCAGCCTCCAGAACCGACGAGATGTGCTCTTGTGAT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGCCAGAATCTTGCAGCATCCACAGCCGCGACTTCCAATGGCAATAAACGTAAACGGCGT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTAAGCAGCGATTCAAACGAGGACCCTGAACTCGGTTTTGAGCCTCCATCAGCTAAGCGC 360

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      361 CAGCAGCGACTGCCCGCTTTGTACGGCAGCGAGCAGGGCAATCTGTCATCGGTTGCCTC 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTCGGTCTACACCTCGCCCGTTGTCTCGGTTGATGGCCAGAGTACCCAGGAGCTGCTCAG 479

3938R-2.IR_full       481 CATACGTAGCTCANCGNCCGAG 501
                          ||||||||||||| || ||||| silico     481 CATACGTAGCTCACCGGCCGAG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  NM_165123.2  CG3938-RC, transcript variant C (CycE), mRNA 
100   482  10  NM_057611.4  CG3938-RA, transcript variant A (CycE), mRNA 
100   482  10  NM_165125.2  CG3938-RE, transcript variant E (CycE), mRNA 
100   482  10  NM_165124.2  CG3938-RD, transcript variant D (CycE), mRNA 
33.81   163  NM_057612.4  CG3938-RB, transcript variant B (CycE), mRNA 
0   39  NM_169874.1  CG4608-RA (bnl), mRNA 
0   11  NM_142598.1  CG17190-RA (CG17190), mRNA 
0   NM_168370.1  CG8177-RB, transcript variant B (CG8177), mRNA 
0   NM_140100.1  CG8177-RA, transcript variant A (CG8177), mRNA 
0   NM_206313.1  CG8177-RI, transcript variant I (CG8177), mRNA 
0   NM_206312.1  CG8177-RJ, transcript variant J (CG8177), mRNA 
0   NM_206311.1  CG8177-RK, transcript variant K (CG8177), mRNA 
0   NM_206314.1  CG8177-RH, transcript variant H (CG8177), mRNA 
0   NM_168372.1  CG8177-RF, transcript variant F (CG8177), mRNA 
0   NM_168369.1  CG8177-RG, transcript variant G (CG8177), mRNA 
0   NM_167087.1  CG3203-RA, transcript variant A (RpL17), mRNA 
0   NM_132118.2  CG3203-RD, transcript variant D (RpL17), mRNA 
0   NM_167089.1  CG3203-RC, transcript variant C (RpL17), mRNA 
0   NM_167088.1  CG3203-RB, transcript variant B (RpL17), mRNA 
0   NM_136591.3  CG8213-RA (CG8213), mRNA 
0   10  NM_205987.1  CG32972-RA, transcript variant A (CG32972), mRNA 
0   10  NM_176037.1  CG32972-RB, transcript variant B (CG32972), mRNA 
0   NM_057379.2  CG8355-RC, transcript variant C (sli), mRNA 
0   NM_057381.2  CG8355-RB, transcript variant B (sli), mRNA 
0   NM_057380.2  CG8355-RA, transcript variant A (sli), mRNA 
0   NM_079985.2  CG5206-RA (bon), mRNA 
0   NM_058053.3  CG6939-RA, transcript variant A (Sbf), mRNA 
0   NM_169430.2  CG6939-RB, transcript variant B (Sbf), mRNA 
0   NM_132372.1  CG15313-RA (CG15313), mRNA 
0   NM_164576.2  CG15427-RD, transcript variant D (tutl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.