National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3931R-2 
 Symbol Rrp4  Full Name Rrp4 
 CG No CG3931  Old CG No CG3931 
 Synonyms RRP4, CG3931, dRrp4, Rrp4 
 Accession No (Link to NCBI) NM_137963.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGTGTATACGCCGGGGGAAGT 
 Primer Seq. 3'
aatctagaggtaccCGCAGGGCAGGTTGTGGAAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGTGTATACG CCGGGGGAAG TGCTGATGCC GGAGGCGGGA TTCATGCGCG GCCACGGAAC 
0061 CTTCGTCGAG GACGAGAACA TCAAGTCCTC GGTGGCCGGG GTGATCCAGA AGGTCAACAA 
0121 GCTGATCTCG GTGCGCCCGC TCAAGAGTCG CTATGTGGGC GAGATCGGGG ACGTGGTGGT 
0181 GGCCCGCGTC AGCGAGGTGC AACAGAAGCG CTGGCGANGT GGACACCAAT TCCCGGCTCG 
0241 ACTCCATCCT ACTGCTCTCC TCGGTGAATC TGCCGGGCGG AGAACTACGG CGGAGATCGG 
0301 CGGAGGACGA GCAGATGATG CGACGATACT TGGACGAGGG CGATCTCATC TCTGCCGAGG 
0361 TCCAGAACAT CTTTGAGGAG GGCTCCCTTT CGCTGTACAC GCGCAGTTTG AAGTATGGAA 
0421 AACTATCGCA GGGCATCCTG GTCAAGGTGT TCCCCGCTCT CGTCAAGCGC CGCAAGATGC 
0481 ACTTCCACAA CCTGCCCTGC G 
 in silico PCR Fragment
0001 GGTGTATACG CCGGGGGAAG TGCTGATGCC GGAGGCGGGA TTCATGCGCG GCCACGGAAC 
0061 CTTCGTCGAG GACGAGAACA TCAAGTCCTC GGTGGCCGGG GTGATCCAGA AGGTCAACAA 
0121 GCTGATCTCG GTGCGCCCGC TTAAGAGTCG CTATGTGGGC GAGATCGGGG ACGTGGTGGT 
0181 GGCCCGCGTC AGCGAGGTGC AACAGAAGCG CTGGCGA-GT GGACACCAAT TCCCGGCTCG 
0241 ACTCCATCCT ACTGCTCTCC TCGGTGAATC TGCCAGGCGG AGAACTACGA CGGAGATCGG 
0301 CGGAGGACGA GCAGATGATG CGACGATACT TGGACGAGGG CGATCTCATC TCTGCCGAGG 
0361 TCCAGAACAT CTTTGAGGAG GGCTCCCTTT CGCTGTACAC GCGCAGTTTG AAGTATGGAA 
0421 AACTATCGCA GGGCATCCTG GTCAAGGTGT TCCCCGCTCT CGTCAAGCGC CGCAAGATGC 
0481 ACTTCCACAA CCTGCCCTGC G 
 Assemble Data

3931R-2.IR_full       1   GGTGTATACGCCGGGGGAAGTGCTGATGCCGGAGGCGGGATTCATGCGCGGCCACGGAAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3931R-2.in silico     1   GGTGTATACGCCGGGGGAAGTGCTGATGCCGGAGGCGGGATTCATGCGCGGCCACGGAAC 60


3931R-2.IR_full       61  CTTCGTCGAGGACGAGAACATCAAGTCCTCGGTGGCCGGGGTGATCCAGAAGGTCAACAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3931R-2.in silico     61  CTTCGTCGAGGACGAGAACATCAAGTCCTCGGTGGCCGGGGTGATCCAGAAGGTCAACAA 120


3931R-2.IR_full       121 GCTGATCTCGGTGCGCCCGCTCAAGAGTCGCTATGTGGGCGAGATCGGGGACGTGGTGGT 180
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
3931R-2.in silico     121 GCTGATCTCGGTGCGCCCGCTTAAGAGTCGCTATGTGGGCGAGATCGGGGACGTGGTGGT 180


3931R-2.IR_full       181 GGCCCGCGTCAGCGAGGTGCAACAGAAGCGCTGGCGANGTGGACACCAATTCCCGGCTCG 240
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
3931R-2.in silico     181 GGCCCGCGTCAGCGAGGTGCAACAGAAGCGCTGGCGA-GTGGACACCAATTCCCGGCTCG 240


3931R-2.IR_full       241 ACTCCATCCTACTGCTCTCCTCGGTGAATCTGCCGGGCGGAGAACTACGGCGGAGATCGG 300
                          |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||
3931R-2.in silico     241 ACTCCATCCTACTGCTCTCCTCGGTGAATCTGCCAGGCGGAGAACTACGACGGAGATCGG 300


3931R-2.IR_full       301 CGGAGGACGAGCAGATGATGCGACGATACTTGGACGAGGGCGATCTCATCTCTGCCGAGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3931R-2.in silico     301 CGGAGGACGAGCAGATGATGCGACGATACTTGGACGAGGGCGATCTCATCTCTGCCGAGG 360


3931R-2.IR_full       361 TCCAGAACATCTTTGAGGAGGGCTCCCTTTCGCTGTACACGCGCAGTTTGAAGTATGGAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3931R-2.in silico     361 TCCAGAACATCTTTGAGGAGGGCTCCCTTTCGCTGTACACGCGCAGTTTGAAGTATGGAA 420


3931R-2.IR_full       421 AACTATCGCAGGGCATCCTGGTCAAGGTGTTCCCCGCTCTCGTCAAGCGCCGCAAGATGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3931R-2.in silico     421 AACTATCGCAGGGCATCCTGGTCAAGGTGTTCCCCGCTCTCGTCAAGCGCCGCAAGATGC 480


3931R-2.IR_full       481 ACTTCCACAACCTGCCCTGCG 501
                          |||||||||||||||||||||
3931R-2.in silico     481 ACTTCCACAACCTGCCCTGCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137963.1  CG3931-RA (Rrp4), mRNA 
0   NM_176252.1  CG33150-RA (Gr59f), mRNA 
0   NM_144078.1  CG18676-RA (Teh3), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_058136.3  CG4376-RA, transcript variant A (Actn), mRNA 
0   NM_058137.3  CG4376-RC, transcript variant C (Actn), mRNA 
0   NM_166920.1  CG4376-RB, transcript variant B (Actn), mRNA 
0   NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0   NM_142396.1  CG7397-RA (CG7397), mRNA 
0   NM_169299.1  CG9495-RA (Scm), mRNA 
0   NM_139364.2  CG1049-RA, transcript variant A (Cct1), mRNA 
0   NM_167894.1  CG1049-RD, transcript variant D (Cct1), mRNA 
0   NM_167892.1  CG1049-RB, transcript variant B (Cct1), mRNA 
0   NM_167893.1  CG1049-RC, transcript variant C (Cct1), mRNA 
0   NM_079611.2  CG18550-RA (yellow-f), mRNA 
0   NM_142890.1  CG17381-RA (CG17381), mRNA 
0   NM_132083.3  CG3815-RA (CG3815), mRNA 
0   NM_079749.4  CG5405-RA, transcript variant A (KrT95D), mRNA 
0   NM_170108.2  CG5405-RB, transcript variant B (KrT95D), mRNA 
0   NM_170110.2  CG5405-RC, transcript variant C (KrT95D), mRNA 
0   NM_136917.2  CG8487-RB, transcript variant B (garz), mRNA 
0   NM_165385.2  CG12548-RA, transcript variant A (nompB), mRNA 
0   NM_078889.3  CG12548-RB, transcript variant B (nompB), mRNA 
0   NM_132320.2  CG12124-RA (CG12124), mRNA 
0   NM_001042881.1  CG8486-RC, transcript variant C (CG8486), mRNA 
0   NM_164795.2  CG8486-RB, transcript variant B (CG8486), mRNA 
0   NM_135344.2  CG8486-RA, transcript variant A (CG8486), mRNA 
0   NM_136983.2  CG17019-RA (CG17019), mRNA 
0   NM_132259.2  CG11219-RA (PIP82), mRNA 
0   NM_139608.2  CG1333-RB, transcript variant B (Ero1L), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.