National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3921R-2 
 Symbol CG3921  Full Name CG3921 
 CG No CG3921  Old CG No CG3921 
 Synonyms CG3921 
 Accession No (Link to NCBI) NM_134964.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGGATCCAAAATGGGCCAGCA 
 Primer Seq. 3'
aatctagaggtaccGGGCAGCTCCAGTTTGTAGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGGATCCAAA ATGGGCCAGC ATATGTTTAT GGCTGCTCGT AACGCTGGCT TTTTCGACCC 
0061 ACTTGGCACG GAGCCAAGNA AAGTCGACAA ACGGAGGACT CCAAAGAGGT GAAACTGCTG 
0121 CAGGATAATG ACATCGAGTT CGCCAGTCTC GATGGCGCCA GCCAACNTAT TGCCAGCAAC 
0181 CCGACATTCC GGCGCAGACG TCACCGTGGC GCCACAAGGT TCCACCCCAT CGATGACGTC 
0241 ATCTTCGTCA TACACCGAGC TGCAAGGCGG CGANAATTCT CAGCGACCGA ATCCTGCGGC 
0301 GCAGCGAGAG TCCTTATTTG GCACGCGACG ATATCGAGGT CCTGCGTGGA GCCCGTTTGA 
0361 CCATCGAACC GGGTGTTACC ATCGAATTCG CCCCCACCAA AGGACTCAAA ATCAACGGCG 
0421 TCCTGCAGGC GGTGNGCACA CCAACCTCCA GAATTGTGTT AAAATCCCAG AGTAACACGG 
0481 CCAACTACAA ACTGGATGCT GCCc 
 in silico PCR Fragment
0001 GGGATCCAAA ATGGGCCAGC ATATGTTTAT GGCTGCTCGT AACGCTGGCT TTTTCGACCC 
0061 ACTTGGCACG GAGCCAAG-A AAGTCGACAA ACGGAGGACT CCAAAGAGGT GGAACTGCTG 
0121 CAGGATAATG ACATCGAGTT CGCCAGTCTC GATGGCGCCA GCCAAC-TAT TGCCAGCAAC 
0181 CCGACATTCC GGCGCAGACG TCACCGTGGC GCCACAAGGT TCCACCCCAT CGATGACGTC 
0241 ATCTTCGTCA TACACCGAGC TGCAAGGCGG CGA-AATCCT CAGCGACCGA ATCCTGCGGC 
0301 GCAGCGAGAG TCCTTATTTG GCACGCGACG ATATCGAGGT CCTGCGTGGA GCCCGTTTGA 
0361 CCATCGAACC GGGTGTTACC ATCGAATTCG CCCCCACCAA AGGACTCAAA ATCAACGGCG 
0421 TCCTGCAGGC GGTGGGCACA CCAACCTCCA GAATTGTGTT AAAATCCCAG AGTAACACGG 
0481 CCAACTACAA ACTGGA-GCT GCCC 
 Assemble Data

3921R-2.IR_full       1   GGGATCCAAAATGGGCCAGCATATGTTTATGGCTGCTCGTAACGCTGGCTTTTTCGACCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3921R-2.in silico     1   GGGATCCAAAATGGGCCAGCATATGTTTATGGCTGCTCGTAACGCTGGCTTTTTCGACCC 60


3921R-2.IR_full       61  ACTTGGCACGGAGCCAAGNAAAGTCGACAAACGGAGGACTCCAAAGAGGTGAAACTGCTG 120
                          |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||
3921R-2.in silico     61  ACTTGGCACGGAGCCAAG-AAAGTCGACAAACGGAGGACTCCAAAGAGGTGGAACTGCTG 120


3921R-2.IR_full       121 CAGGATAATGACATCGAGTTCGCCAGTCTCGATGGCGCCAGCCAACNTATTGCCAGCAAC 180
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
3921R-2.in silico     121 CAGGATAATGACATCGAGTTCGCCAGTCTCGATGGCGCCAGCCAAC-TATTGCCAGCAAC 180


3921R-2.IR_full       181 CCGACATTCCGGCGCAGACGTCACCGTGGCGCCACAAGGTTCCACCCCATCGATGACGTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3921R-2.in silico     181 CCGACATTCCGGCGCAGACGTCACCGTGGCGCCACAAGGTTCCACCCCATCGATGACGTC 240


3921R-2.IR_full       241 ATCTTCGTCATACACCGAGCTGCAAGGCGGCGANAATTCTCAGCGACCGAATCCTGCGGC 300
                          ||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||
3921R-2.in silico     241 ATCTTCGTCATACACCGAGCTGCAAGGCGGCGA-AATCCTCAGCGACCGAATCCTGCGGC 300


3921R-2.IR_full       301 GCAGCGAGAGTCCTTATTTGGCACGCGACGATATCGAGGTCCTGCGTGGAGCCCGTTTGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3921R-2.in silico     301 GCAGCGAGAGTCCTTATTTGGCACGCGACGATATCGAGGTCCTGCGTGGAGCCCGTTTGA 360


3921R-2.IR_full       361 CCATCGAACCGGGTGTTACCATCGAATTCGCCCCCACCAAAGGACTCAAAATCAACGGCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3921R-2.in silico     361 CCATCGAACCGGGTGTTACCATCGAATTCGCCCCCACCAAAGGACTCAAAATCAACGGCG 420


3921R-2.IR_full       421 TCCTGCAGGCGGTGNGCACACCAACCTCCAGAATTGTGTTAAAATCCCAGAGTAACACGG 480
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
3921R-2.in silico     421 TCCTGCAGGCGGTGGGCACACCAACCTCCAGAATTGTGTTAAAATCCCAGAGTAACACGG 480


3921R-2.IR_full       481 CCAACTACAAACTGGATGCTGCCC 504
                          |||||||||||||||| |||||||
3921R-2.in silico     481 CCAACTACAAACTGGA-GCTGCCC 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134964.1  CG3921-RA (CG3921), mRNA 
0   NM_134980.1  CG17612-RA, transcript variant A (CG17612), mRNA 
0   NM_164581.1  CG17612-RB, transcript variant B (CG17612), mRNA 
0   NM_167729.1  CG15445-RA, transcript variant A (CG15445), mRNA 
0   NM_134592.2  CG15445-RD, transcript variant D (CG15445), mRNA 
0   NM_167730.1  CG15445-RB, transcript variant B (CG15445), mRNA 
0   NM_167731.1  CG15445-RC, transcript variant C (CG15445), mRNA 
0   NM_134503.2  CG14231-RA (CG14231), mRNA 
0   NM_132059.2  CG4766-RA (CG4766), mRNA 
0   NM_136122.2  CG9994-RA (Rab9), mRNA 
0   NM_057257.3  CG7664-RA (crp), mRNA 
0   NM_206227.1  CG12038-RA, transcript variant A (CG12038), mRNA 
0   NM_206226.1  CG12038-RB, transcript variant B (CG12038), mRNA 
0   NM_169587.1  CG7987-RB, transcript variant B (CG7987), mRNA 
0   NM_165594.1  CG8708-RB, transcript variant B (CG8708), mRNA 
0   NM_136516.2  CG8708-RA, transcript variant A (CG8708), mRNA 
0   NM_142118.1  CG7987-RA, transcript variant A (CG7987), mRNA 
0   NM_080306.2  CG3443-RB (pcx), mRNA 
0   NM_140607.1  CG13045-RA (CG13045), mRNA 
0   NM_001043247.1  CG6535-RB (tefu), mRNA 
0   NM_166258.1  CG5784-RA, transcript variant A (Mapmodulin), mRNA 
0   NM_079056.2  CG5784-RB, transcript variant B (Mapmodulin), mRNA 
0   NM_136830.4  CG12388-RA (kappaTry), mRNA 
0   NM_134517.2  CG15618-RA (CG15618), mRNA 
0   NM_080014.2  CG3064-RB (futsch), mRNA 
0   NM_137337.1  CG9640-RA (CG9640), mRNA 
0   NM_139584.1  CG14982-RB (CG14982), mRNA 
0   NM_057397.3  CG8049-RB, transcript variant B (Btk29A), mRNA 
0   NM_164804.1  CG8049-RD, transcript variant D (Btk29A), mRNA 
0   NM_136120.1  CG13085-RA (CG13085), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.